... MSU Graphics & Media Lab (Video Group) . The algorithm allows to increase video frame rate (fps) by the factor equal to any integer number. ... Frame rate conversion is done as shown on the picture below: . ... arbitrary whole number of interpolated frames between reference frames. ... Segmentation of original frames with detection of areas with complex motion allows to avoid visual degradation of interpolated frames even on scenes with hard motion. ... Video Frame Rate Double Up-Conversion . ...

Еще в разделе: (Показать все результаты (>996) - graphics.cs.msu.ru/ )

• Video Frame Rate N-Times Up-Conversion | Лаборатория компьютерной графики и
• Video Frame Rate Double Up-Conversion | Graphics and Media Lab
• x264 codec improvement | Graphics and Media Lab

Pixies . The Pixies (Physiological Information eXtraction from ImagE Sequences) project is to develop a user-friendly application dedicated to the analysis of biomedical image series and including sophisticated analysis tools developped within a research lab that has been involved in the analysis of medical image series for almost twenty years. ... There will be 3 different Pixies versions: . ... SAL Home | Computer Graphics, Images Signals | Processing Visualization . ...

Еще в разделе: (Показать все результаты (>3170) - www.sai.msu.su/ )

• SAL- Computer Graphics, Images Signals - Processing Visualization - MegaWave2
• SAL- Computer Graphics, Images Signals - Misc - TINA
• SAL- Computer Graphics, Images Signals - Processing Visualization - Viewit

... Method of recursive sequences in associated liquids theory . ... In case of chain association the comparison of RS-method with earlier developed matrix technique is performed. ... Moscow University Chemistry Bulletin . 2011, Vol. ... 3, P. 175 . Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ... Web-design: Copyright (C) MIG and VVM . ...

Еще в разделе: (Показать все результаты (>824) - chem.msu.ru/ )

• Conjunction of thermal lens spectrometry and high-performance liquid
• Moscow University Chemistry Bulletin Vol. 49, No. 2, P. 96 (2008)

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>385) - geo.web.ru/ )

• COMAGMAT MODEL

... The Scenario Machine method to calculate evolution of binary stars is basically a Monte-Carlo method for statistical simulation of large ensembles of stellar binary systems originally used by Kornilov & Lipunov (1983) for massive binaries and developed later by Lipunov & Postnov (1987) for low-mass binaries (for the most recent review, see Lipunov, Postnov &Prokhorov, 1996 (LPP96)). ... This is not the first example of the WWW representation of the stellar evolution. ... Fri Jun 21 19:17:07 MSD 1996...

Еще в разделе: (Показать все результаты (>435) - xray.sai.msu.ru/ )

• The Model

Application of evolutionary model in the evaluation of the quality of pair wise alignment of amino acid sequences Valery Polyanovsky, V. G. Tumanyan Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow, 119991 Russia ... : polyanovskyvo@mailfrom.ru, tuman@eimb.ru The purpose of the work is to develop a universal method for estimating the pairwise alignment quality depending on the evolutionary distance (degree of homology) between the ... REFERENCES 1. ...

Еще в разделе: (Показать все результаты (>298) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/4.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/106.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/20.pdf

... First, calculate percentages of amino acids in every column + contribution = 1.0 / len ( self . sequences ) + all_columns = [] + for position in range( len ( self )): + column _percentage = {} + for seq in self.body : + if self.body [seq][position] is not None : + aa = self.body [seq][position].code + else: + aa = None + if aa in allpy.data.amino_acids: + if aa in column _percentage.keys(): + ...

Еще в разделе: (Показать все результаты (>31449) - kodomo.fbb.msu.ru/ )

• allpy: 59320c160dae
• allpy: 62e38970ffa2
• allpy: b7b963287d31 lib/project.py

Электронная библиотека Попечительского совета . ... Mangano S. - XSLT Cookbook . ... Название: XSLT Cookbook . ... The 136 solutions to commons problems address string processing, mathematics, dates and times, document traversal, XML queries, HTML, scalable vector graphics, code generation, debugging, and generic programming. ... automation, code generation, XSLT from XSLT . ... Code . ... code, generation, XSLT from XSLT . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>15478) - lib.mexmat.ru/ )

• Phillips P.P., Burkett H. - Data Conversion: Calculating the Monetary Benefits
• Kirk D. - Graphics gems (Vol. 3) :: Электронная библиотека попечительского
• Paeth A.W. (ed.) - Graphics gems (volume 5) :: Электронная библиотека

... Bioinformatics Portal . GeneBee . ... Bioinformatics Portal of A.N.Belozersky Institute, . Moscow State University . Supported by the Russian Foundation for Basic Research, grant 13-07-00969-a . Original Services of GeneBee Group . Databanks screening . Sequence analysis . Screening by keywords . AliBee Multiple alignment Release 3.0 . AliGraf Graphical Alignment . AliComp Alignments Comparison . Screening by similarity Release 3.0 . ...

Еще в разделе: (Показать все результаты (>214) - www.genebee.msu.ru/ )

• GeneBee

... Implementation of parallel calculations on graphics processor units in the LOGOS computational fluid dynamics package" . ... The speed-up of calculations performed on graphics processor units compared to the calculations performed on the corresponding central processor unit is analyzed. Keywords: graphics processor unit, parallel algorithm, gas dynamics, finite volume method, unstructured mesh, CUDA technology, LOGOS package . ...

Еще в разделе: (Показать все результаты (>548) - num-meth.srcc.msu.ru/ )

• "An algorithm for calculating the equilibrium state of a ferromagnetic by the
• "Numerical aspects of the calculation of scaling factors from experimental...
• "A numerical scheme for simulating the dynamics of surface water on the basis

SAI, graduates year 1982. ... Note: when just a 7-digit phone number is shown, it refers to a phone located in Moscow (international access 007-495). "+" in front of a number means that you must dial an international access code first (or just press "+" on your mobile phone keypad). ... 939-1672(work); . ... Ataev Sasha . 1-(703)-536-8881(home) (USA); . ... Bychkov Sergey . ... 1-(410)-740-8205(home), +1-(301)-286-2150(work) (USA); . ... 1-(412)-767-0332(home), +1-(412)-608-9339(mobile) (USA); . ...

Еще в разделе: (Показать все результаты (>19) - uranus.sai.msu.ru/ )

SPECIAL ISSUE OF CATENA “RECONSTRUCTION AND CLIMATIC IMPLICATIONS OF PALEOSOLS” (Volume 34 nos 1-2 . ... This special issue of Catena contains twelve papers originally presented at a symposium entitled Reconstruction and Climatic Implications of Quaternary Paleosols and Paleosol Sequences, which was held at the XIV International Congress of INQUA (International Union for Quaternary Research) in Berlin 1995, and was organized by INQUA Commission VI (Paleopedology). ... VOLUME 34 NOS. 1-2 . ...

Еще в разделе: (Показать все результаты (>162) - www.fadr.msu.ru/ )

• Abstracts
• THE POST-SIMPOSIUM EXCURSION (July 31 - August 7,1998)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'D' . Journal title [?] ... biology . ... Blackwell Publishing ] . ... Development . ... Developmental and Comparative Immunology . Elsevier Science ] . ... Developmental Biology . ... Developmental Biology BMC . ... Developmental Science . ... Doklady Biochemistry and Biophysics - Proceedings of the .. ... Doklady Biological Sciences . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>201) - journals.genebee.msu.ru/ )

• JCatalog - Different journal alphabetic indexes

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>94) - www.intsys.msu.ru/ )

BOOM-TC2 - BOOM: Shadow of The Zedix (version 2) A Total Conversion for Ultimate Doom v1.9 featuring a complete episode (9 maps), new sounds and graphics, new monsters and new weapons. ... The original version contained an illegal hacked doom.exe; this version has an equivalent DeHackEd patch, so you can either patch your own legal copy of doom.exe, or just run it directly with an appropriate Source Port. ... If you haven't version 1.9 of DOOM already, get the update patch. ...

Еще в разделе: (Показать все результаты (>4158) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/g-i/hellu101.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/a-c/bfgvault.txt
• Introduction

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>57) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis

Sulimov A.V., Kutov D.K., Katkova E.V., Sulimov V.B. Application of the docking program SOL for CSAR benchmark // 244th ACS National Meeting, Philadelphia, Pennsylvania, USA, 19-23 August, 2012 . Docking program SOL and postprocessing were tested against CSAR Benchmark. ... At CSAR benchmark SOL demonstrates good performance for two target-proteins and bad one for another two proteins. ... Ключевые слова: Docking, SOL, CSAR, force field ...

Еще в разделе: (Показать все результаты (>116) - srcc.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Market >> Market (Archive) . ... Original IntellijIDEA license ? ... If you are searching for a one year original license of the worlds most powerful/popular and appraised . ...

Еще в разделе: (Показать все результаты (>4085) - www.fds-net.ru/ )

• [продам] Кофе зерновой Paulig Espresso Originale, 1кг - Public forum of MSU
• Куплю кабель Nokia CA-42 Original - Public forum of MSU united student networks

fltk: fltk (The Fast Light Tool Kit) fltk: fltk: The Fast Light Tool Kit ("FLTK", pronounced "fulltick") is a a cross- fltk: platform C++ GUI toolkit for UNIX(r)/Linux(r) (X11), Microsoft(r) fltk: Windows(r), and MacOS(r) X. FLTK provides modern GUI functionality fltk: without the bloat and supports 3D graphics via OpenGL(r) and its fltk: built-in GLUT emulation. The Fast Light Tool Kit was originally fltk: developed by Mr. Bill Spitzak. fltk: fltk: fltk home: http://www.fltk.org fltk:

Еще в разделе: (Показать все результаты (>17661) - mirror.msu.net/ )

• http://mirror.msu.net/pub/slackware-current/slackware/l/libvpx-1.5.0-i586-1.txt
• http://mirror.msu.net/pub/slackware-current/slackware/l/djvulibre-3.5.27-i586-1.txt
• http://mirror.msu.net/pub/slackware-current/slackware/d/gcc-objc-5.3.0-i586-3.txt