... Moscow, Russia . ... Moscow State University (MSU), Department of Physics, . ... Analysis features of block copolymer thin films by atomic-force microscopy ? ... Courses of English Language, Moscow State University . ... Researcher, Laboratory of Scanning Probe Microscopy , Department of Physics, Moscow State University (MSU) . ... Bolshakova A.V., Yaminsky I.V. Analysis of block-copolymer films structure by atomic force microscopy // Moscow University Physics Bulletin, 2009, No 2 (in press) . ...

Еще в разделе: (Показать все результаты (>121) - www.spm.genebee.msu.ru/ )

• Bagrov Dmitry
• Alexander S. Filonov Professional Publications
• Alexey Dobrynin - personal web page

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

• Solar Physics Department

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>4) - ged.chem.msu.ru/ )

... Kingdon, Penning and Paul ion traps invented correspondingly in 1923, 1936 and 1956 have played essential role in 20th century physics- test of the validity of quantum electrodynamics, tests of symmetry properties of fundamental laws-particle-antiparticle (electron-positron), the electric dipole moment of the neutron, ion spectroscopy, hyromagnetic ratio, comparison of masses m(p+/m(e-) m(CO+)/m(N2+) frequency and time standards, dusty plasma and so on. ... 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>106) - www.msm.biophys.msu.ru/ )

• Conference Organizing Committee

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... О факультете . ... Лекторий МГУ . ... Новости ФББ . Новости МГУ . ... Лекторий МГУ: 19 апреля, Ольга Александровна Филатова . 2016 . ... Программа секции "Биоинженерия и биоинформатика" . ... Олимпиада ФББ МГУ . ... Факультет биоинженерии и биоинформатики был создан на базе НИИ ФХБ им.А.Н.Белозерского МГУ в 2002 году. ... Факультет биоинженерии и биоинформатики, комната 433. ... 2016 Факультет биоинженерии и биоинформатики . Московского Государственного Университета имени М.В.Ломоносова . ...

Еще в разделе: (Показать все результаты (>2) - www.fbb.msu.ru/ )

Speech of the Head of the Federal Agency for Education Mr. G.A. Balykhin at the leading higher school institutions of Russia and China forum "The role of international cooperation in the Higher Education Quality Increase" Dear rectors of the leading Higher School Institutions of Russia and China! ... Dear rectors! ... As you know, the 1st Forum was held in Peking University, during the "Year of Russia in China". ... Best wishes, good luck, the 2nd Forum of Rectors of Russia and China! ...

Еще в разделе: (Показать все результаты (>57) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/94.doc
• http://www.rsr-online.ru/doc/norm/328.doc
• http://www.rsr-online.ru/doc/2011_09_26/4.pdf

... Data . ... All links ] [ Models ] [ Space weather ] [ Research Institutions ] [ Data sources ] [ News sites ] [ Satellites ] [ Local library ] [ Education ] [ Journals ] [ Events ] . ... NSSDC Space Physics Models . ... Solar Influences Data analysis Center (Royal Observatory of Belgium) . ... Space Weather News Data Base . ... Space Weather Resources (NSSDC) . ... AAS Solar Planetary Division (AAS SPD) . ... Russian Space Science Internet . ... National Space Science Data Center (NSSDC) . ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• Space monitoring data center INTERHELIOS PROJECT
• Space monitoring data center
• Coronas-I - Space monitoring data center

... about ERC . education . research . ... The Lomonosov Moscow State University (MSU) has been training specialists in nanotechnology, nanomaterials and nanosystems for nearly ten years . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... Fundamentals of Nanotechnology? was the first step in ERC?s activity. ...

Еще в разделе: (Показать все результаты (>54) - nano.msu.ru/ )

• The 7th International Nanoscience Student Conference, London, 19?22 August 2013
• Events | MSU Nanotechnology Education and Research Center
• Statutes of the MSU Nanotechnology Education and Research Center | MSU

Chemistry, Catalysis and Gas Electrochemistry . ... Chemical Departments of Universities and Chemical Science Institutes . Chemistry Links Collections . ... CEPAC Chemical Engineering of Pan-American Collaboration (USA Universities and Departments with Research Activities in Catalysis) This resource contain more 200 names, addresses and personal web-pages of chemists from USA and Canada. Ozone . ... Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. ...

Еще в разделе: (Показать все результаты (>88) - www.kge.msu.ru/ )

• Ozone Workshop
• Laboratory of Catalysis and Gas Electrochemistry
• Archive

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>39) - monkey.belozersky.msu.ru/ )

• Internet Services
• DNA/RNA-Protein structures

... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...

Еще в разделе: (Показать все результаты (>2) - sphere.sinp.msu.ru/ )

... Kornev, V., Sharafiev, A., Kolotinskiy, N., and Mukhanov, O. Microwave dynamics of superconducting quantum cell.љ ... DOI љ] . ... Kornev, V., Sharafiev, A., Soloviev, I., and Mukhanov, O. Signal and noise characteristics of bi-squid.љ ... Kornev, V., Sharafiev, A., Soloviev, I., Kolotinskiy, N., Skripka, V., and Mukhanov, O. Superconducting quantum arrays.љ ... Kornev, V., Sharafiev, A., Soloviev, I., Kolotinskiy, N., and Mukhanov, O. Superconducting quantum arrays for broadband rf systems.љ ...

Еще в разделе: (Показать все результаты (>38) - cryolab.phys.msu.ru/ )

• Dmitriy A. Khrykin
• Nikolay V. Kolotinskiy
• Ivan V. Sapkov

... Институт русского языка и культуры - учебное подразделение љ МГУ имени М.В.Ломоносова , которое занимается преподаванием русского языка как иностранного и неродного,љподготовкой иностранных граждан к обучению на профильных факультетах МГУ и в других высших учебных заведениях России, повышением квалификации и переподготовкой специалистов по профилю РКИ, тестированием, а также распространением и продвижением русского языка во всем мире. ... Институт русского языка и культуры МГУ имени М. В. Ломоносова...

176. WebHome < _default < Foswiki

177. A Problem with Fear - Фильмы - Kinfo.ru

178. Студенческий форум Физфака МГУ > DjVu problem

179. Ресурсы Интернет по численному анализу

180. http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download