... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf -- 388.0 Кб -- 06.07.2014 Похожие документы
... The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Stable self -mode-locking occurs due to time delay in feedback control system corresponding to light pulse passage through the Pockels cell at the moment of low intracavity losses. ... The scheme of discontinuous control in the laser is shown in Fig. ...
... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...
[
Текст
]
Ссылки http://www.geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016 Похожие документы
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
... Preferences . ... Date & Time . ... Time zone: Default time zone Africa/Abidjan Africa/Accra Africa/Addis_Ababa Africa/Algiers Africa/Asmara Africa/Bamako Africa/Bangui Africa/Banjul Africa ... Africa/Niamey Africa/Nouakchott Africa/Ouagadougou Africa/Porto-Novo Africa/Sao_Tome Africa/Tripoli Africa/Tunis Africa/Windhoek America /Adak America /Anchorage America /Anguilla America /Antigua America /Araguaina America /Argentina/Buenos_Aires America /Argentina/Catamarca ...
Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012 Похожие документы
... Printed in U.S.A. AN EXTRA LONG X-RAY PLATEAU IN A GAMMA-RAY BURST AND THE SPINAR PARADIGM V. Lipunov1, 2, 3 and E. Gorbovskoy 1, 2, 3 Received 2007 May 3; accepted 2007 June 25; published 2007 August 6 ABSTRACT The recently discovered gamma-ray burst GRB 070110 displayed an extraordinar y X-ray afterglow with Xray radiation--i.e., an X-ray ... 2006; Wang & Meszaros 2007). ... It is followed by a slow collapse (the magnetic field is weak), which results in a weak X-ray burst. ...
[
Текст
]
Ссылки http://observ.pereplet.ru/images/evgeny/article/2007/ApjLettt.pdf -- 201.3 Кб -- 27.09.2007 Похожие документы
... A one-dimensional model of shallow reservoir thermodynamics either describing physical processes in underlying soil layer is constructed. The model simulates seasonal dynamics of lake (including ice and snow layer formation) and year to year variability. A number of numerical experiments is performed; model and natural data are compared. ... S = S0 (sin cos + cos cos cos ). ... 2002, C. 8387. ... Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, Oak Ridge, Tennessee. ...
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
... for Food Security . ... One of the major activities of the Eurasian Center for Food Security is to conduct research and analysis, which would help to improve functioning of major agro-food markets in the Eurasian region in view of global market of agricultural and food products. agricultural markets . ... Online Consultation on Network and Partnerships in the area of Food Security read . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
... Alexey Andreev БЂ“ Deputy Dean of the General Affairs and Strategic Development of the Faculty of Global Studies MSU, Associate Professor . ... Academic Council of the Faculty of Global Studies . ... Moscow Interdisciplinary Summit: ?New global challenges? . ... Home Search results for ' ' (Page 312) . ... Currently Dean of the Faculty of Global Studies of the Moscow State University. ... Globalistics and Globalization Studies / Ed. by L. E. Grinin, I.V. Ilyin, and A.V. Korotayev, pp.б 107БЂ“118. ...
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...
... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf -- 1713.8 Кб -- 21.11.2008 Похожие документы
... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы