Документ взят из кэша поисковой машины. Адрес оригинального документа : http://herba.msu.ru/shipunov/author/shipunov2005a.pdf
Дата изменения: Sat Apr 9 23:02:26 2005
Дата индексирования: Mon Oct 1 22:17:00 2012
Кодировка:

Original Article EVOLUTION OF DACTYLORHIZA BALTICA A. P. SHIPUNOV ET AL.

Botanical Journal of the Linnean Society, 2005, 147, 257 274. With 7 figures

Evolution of Dactylorhiza baltica (Orchidaceae) in European Russia: evidence from molecular markers and morphology
ALEXEY B. SHIPUNOV*, MICHAEL F. FAY and MARK W. CHASE
Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3DS, UK
Received November 2003; accepted for publication September 2004

Four plastid markers, four nuclear markers and 14 morphometric characters were used in this study to investigate the evolution of Dactylorhiza baltica (Orchidaceae) in European Russia. In total, 98, 214 and 775 samples from 85, 112 and 121 populations were involved in the combined and separate molecular and morphometric analyses, respectively. In most cases, morphometric measures were done on exactly the same plants that were used for DNA studies. Dactylorhiza baltica plants from European Russia are most probably the products of several recent and mostly local hybridization events between the diploids D. fuchsii and D. incarnata, which have each been the maternal parent on different occasions. Considerable introgression into the parental diploids via the allopolyploid D. baltica is also hypothesized. Several morphological characters, such as length of the lip lateral lobe and the length of longest leaf, were found to be robust and could be useful in identification of D. baltica. This study demonstrates the advantage of `combined' techniques, especially in the case of taxonomically complex taxa. © 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257274.

ADDITIONAL KEYWORDS: allotetraploids microsatellites morphometrics systematics.

INTRODUCTION
Dactylorhiza Necker ex Nevski (Orchidaceae) is, along with Epipactis and Ophrys, one of the most taxonomically controversial orchid genera in Europe. There is great instability in the accepted number of species and infraspecific taxa. The borders between many species are unclear, and there are considerable difficulties in the determination of single plants ( Averyanov, 1990; Reinhard, 1990; Delforge, 1995; Stace, 1997; Bateman, 2001). Many of the most problematic taxa are allotetraploids, most of which are believed to be the result of multiple hybridization events between two broadly defined parental species, D. fuchsii (Druce) SoС and D. incarnata (L.) SoС (Heslop-Harrison, 1968; HedrИn, 2002; Devos et al., 2003; Y. Pillon, unpubl. data). Multiple lines of evidence indicate that this complex is an `. . . unusually dynamic system of polyploid speciation

*Corresponding author. E-mail: a.shipunov@kew.org

and extinction in which polyploids evolve continuously from the same set of broadly defi ned parental lineages' (HedrИn, 2003: 2678). Furthermore, the limits of the diploid parental taxa are sometimes made less c lear by the exchange of genetic material, hypothesized to be via allotetraploids (HedrИn, Fay & Chase, 2001; HedrИn, 2003), in spite of the differences in their ploidy. One good example of such polyploid species and at the same time a less well known member of this complex is D. baltica (Klinge) Orlova, for which the distribution, unlike other named allotetraploids of this complex (which occur principally in western Europe), is restricted to the eastern part of Germany, Poland, the Baltic countries, southern Finland and Russia. The eastern parts of its distribution are less defi nite; some authors (Nevski, 1935; Smoljaninova, 1976) have argued that it is restricted to the western parts of European Russia (Pskov and Leningrad regions) together with some localities in the northern Urals and southern Siberia, whereas others expand the European portion across all of European Russia

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

257

258

A. P. SHIPUNOV ET AL. cies was later upgraded to species rank by Nevski (1935) because there are some obvious morphological differences between D. majalis s.s. and D. baltica, especially in leaf form and lip shape ( Table 1). Most authors now accept D. baltica as a separate species, some suggesting that D. praetermissa (Druce) SoС and D. purpurella (T. & T.A.Stephenson) SoС are its closest relatives (e.g. Vermeulen, 1947; Senghas, 1968; Averyanov, 1990). Morphological characters advocated for distinguishing D. baltica vary among authors (Table 1), although most descriptions mention the long, pointed leaves, short inflorescence and relatively wide lip with small lateral lobes. Recent morphometric investigations ha ve shown that Dactylorhiza allotetraploids often have morphological character states that are generally intermediate between D. incarnata and D. fuchsii (e.g. Tyteca & Gathoye, 1993). Biochemical and molecular methods can highlight molecular markers that are able to reveal inheritance, parentage and possible introgression between taxa. Studies of allozyme markers (HedrИn, 2002), AFLPs (HedrИn et al., 2001), plastid markers and ITS alleles (Y. Pillon, unpubl. data) and plastid RFLPs (HedrИn, 2003) showed that: (1) most allotetraploids have indeed originated from hybridization between D. incarnata and D. fuchsii or D. maculata (L.) SoС; (2) they have originated several times (and are most likely still being generated); (3) most western European allotetraploids are easily distinguished by molecular characters from their parental species; (4) most allotetraploids have inherited plastid markers from either D. fuchsii or D. maculata rather than from D. incarnata, indicating that D. fuchsii and D. maculata are more often maternal parents; and (5) some allotetraploids ha ve acquired markers thus far not found in parental taxa ( HedrИn et al. 2001; HedrИn, 2003; Devos et al., 2003; Y. Pillon, unpubl. data; Shipunov et al., 2004).

(between the Arctic Circle and 50N latitude) to the Urals (SoС, 1980; Averyanov, 1990). The most recent evidence is, however, that `D. baltica' populations in the southern Urals have been misidentified and should be assigned to D. fuchsii (Kulikov & Filippov, 1999a). Thus, current opinion limits the distribution of D. baltica in European Russia to between 50 and 60 N latitude (with two exceptions in the northern Urals) and west of 60 longitude (Fig. 1). The epithet baltica was first used by Klinge (1895, 1898) for a subspecies of `Orchis' latifolia L., nom. illeg. [= Dactylorhiza majalis (Reichb.) P.F.Hunt & Summerhayes], a species with a western European distribution, long believed to be another member of the polyploid complex ( Averyanov, 1990). This subspe-

0 200 400

Figure 1. The putative European distribution of Dactylorhiza baltica (Averyanov, 1990; Kulikov & Filippov, 1999a). Each collection site is labelled with an abbreviated region name (see Appendix 1).

Table 1. The most diagnostic morphological characters of Dactylorhiza baltica in this study compared with those from three previous studies (all measurements in millimetres) Characters Plant height Leaf length Leaf width Leaf spots (1 light, 2 heavy) Length of inflorescence Length of lowest bract Spur length Lip length Lip width Length of lip middle lobe (from the base of sinuses) Klinge (1898) 250700 100250 1535 1 2080 69 67 812 <3 Nevski (1935) 300600 90200 2032 1 3095 2030 7.59 78.5 910 2.53.5 Delforge (1995) 250700 100250 1540 1 30100 69 69 813 This study 250700 90250 1540 12 20100 >20 69 69 713 <4

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

EVOLUTION OF DACTYLORHIZA BALTICA However, no molecular analysis has yet been performed on D. baltica, which is unique among other Dactylorhiza allotetraploids due its eastern distribution and relative isolation from other allotetraploids . Moreover, there are few morphometric studies of Russian dactylorchids (Kulikov & Filippov, 1999a, b). Our recent investigation of European Russian Dactylorhiza showed good agreement between morphometric characters and molecular markers suc h as plastid microsatellites and ITS alleles ( Shipunov et al., 2004). Plastid microsatellites had previously been shown to be useful for revealing geographical patterns, the maternal parentage of hybrids, and even some relationships among populations (Y. Pillon, unpubl. data; Shipunov et al., 2004). ITS alleles, on the other hand, generate clear phylogenetic patterns and thereby help to distinguish species ( Bateman et al., 2003), but their biparental inheritance and especially ITS conversion following allopolyploid events (Chase et al., 2003) can blur species boundaries. Pillon (Y. Pillon, unpubl. data) studied the D. maculata complex (primarily D. maculata s.s. and D. fuchsii), the D. incarnata complex and their allotetraploid derivatives throughout their ranges , but particularly in western and northern Europe . We have made use of the markers (plastid microsatellites and ITS sequences) identifi ed in this study. Shipunov et al. (2004) used the same markers to study general patterns of these same species and allotetraploid complexes in Russian Europe . The goal of this study is to explore diversity in detail in one of the Russian allotetraploid taxa, D. baltica, via morphological and molecular markers in the context of its likely origin via hybridization between the D. fuchsii and D. incarnata aggregates (both are treated as broadly defi ned species for simplicity). To the two sets of markers developed in Shipunov et al. (2004) and Y. Pillon (unpubl. data), we have added a set of two nuclear microsatellite markers, which we hope will be more variable than ITS and thus reveal more structure among populations of the putative parental taxa. We chose to focus on this allotetraploid taxon because it appeared to us that it w as likely to be operating locally as a `bridge' between the diploid taxa and would therefore make an appropriate subject for a more detailed study to determine whether we could detect evidence of this phenomenon though the study of both morphological and molecular markers.

259

investigation (see Appendix). All incoming samples were initially identified and assigned to a priori species by experts in regional fl oras (G. Konechnaja and I. Kucherov in Botanical Institute, Saint-Petersburg; N. Reshetnikova in Main Botanical Garden, Moscow and M. Vakhrameeva in Moscow University). In total, 98, 214 and 775 samples from 85, 112 and 121 populations were involved in simultaneous combined and molecular and morphometric analyses, respectively. For most analyses, we used a subset of samples that consisted of the allotetraploid species together with the putative parental species, D. fuchsii s.l. and D. incarnata s.l. One herbarium sample of D. baltica (Smolensk region, A. Averyanov, 2000, LE) and one of D. traunsteineri (Saut. ex Reichb.) SoС (Karelia, I. Kucherov, 1999, LE) were used as yardsticks for morphological comparison and also for DNA extraction. One sample of D. baltica from Estonia in the RBG K ew DNA Bank (Chase 9485) was also used for sequencing.

MOLECULAR

MARKERS

MATERIAL AND METHODS
Some of the (Shipunov et pean Russia regions) and samples were used in a previous study al., 2004), but many samples from Euro(mostly from central and north-western Britain were newly collected for this

Samples for DNA extraction were dried in silica gel (Chase & Hills, 1991). DNA was extracted by the 2 Ґ CTAB protocol (Doyle & Doyle, 1987 but without an RNA treatment). PCR was performed with a set of primers designed by Y. Pillon & M. F. Fay (unpubl. data) to amplify four polymorphic plastid loci: Orch1, Msf, Ms1 and Ms2, located in three plastid DNA regions: the trnS-trnG spacer, trnL intron and trnLtrnF spacer. Two pairs of specific primers were also used to amplify length-variable regions of ITS ribosomal DNA that, taken together, indicate which ITS alleles are found in each sample (Shipunov et al., 2004; Y. Pillon, unpubl. data). To identify other molecular makers that are sufficiently polymorphic to reveal interpopulational structure, we have developed several nuclear microsatellites, two of which proved useful for this study. To develop these markers, we used a strategy proposed by Fisher, Gardner & Richardson (1996), which employs a degenerate primer PCT4 ( Brachet et al., 1999) that contains a (CT)6 repeat at its 3ў end. The conditions for PCR amplifi cation were those of Fisher et al. (1996). Several PCR products were c loned using the Promega pGEM-T Easy Vector System. These were reamplified from transformed bacterial colonies by touching them with a sterile toothpic k and using that sample as the template in a further round of PCR. Primers for this PCR were located on the vector. Amplified DNA fragments were purifi ed using QIAquick PCR mini-columns (QIAGEN, Inc.), following the manufacturer's protocols, and sequenced on a 3100 genetic analyser (Applied Biosystems Inc .), following the manufacturer's protocols (we again used the primers that annealed to sites on the vector).

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

260

A. P. SHIPUNOV ET AL.

Table 2. Nuclear microsatellite loci used Locus Repeat Annealing temperature, C Size range in base pairs (bp) No. of alleles Primer sequence (5ў-3ў) Forward Reverse Da963_1-2 (CAG)5 52 103120 5 TCCATATCCCCCTTCCTCAA CTCTCTCTCTCTTGTCTTTA Ds3978_2-1 (TTA)6 52 126153 10 GAGATATATAGAGTGGTGGT TATGCGTTGGTATTGGGAGT

Sequence editing and assembly of the two complementary strands used SequenceNa vigator and AutoAssembler (Applied Biosystems Inc.) software. Several pairs of specific primers were subsequently designed to amplify the most promising microsatellite loci. The resulting fragments were checked to determine whether they revealed any polymorphisms , and two loci were then chosen for this investigation ( Tables 2, 3). The size of each fragment was determined using GeneScan and Genotyper software (Applied Biosystems Inc.). The subsequent unweighted pair-group (UPGMA) tree construction used PAUP* version 4.0b10 (Swofford, 2000). For most statistical analyses, the calculation of distances between samples w as based on the proportion of shared alleles.

Table 3. Nuclear microsatellites alleles most typical for some Dactylorhiza species Typical lengths (base pairs) and names for alleles Locus Da9631-2 Ds39782-1 D. incarnata 110 (da110) 126 (ds126) D. fuchsii 114 118 130 153 (da114), (da118) (ds130), (ds153) D. maculata 103 (da103) 143 (ds143), 147 (ds147)

Windows (Venables, Smith & R Development Core Team, 2002).

MORPHOLOGY
We used the set of 14 morphological c haracters, slightly modified from previous work ( Shipunov et al., 2004). These characters were measured in nature on either the same plants that were used for DNA extractions or, on a few occasions (e.g. for D. praetermissa and several populations of D. baltica), we measured neighbouring plants in the same population. We used principal component analysis (PC A) and multidimensional scaling (MDS) of individual and population data. In the latter case, population medians (because these are usually more robust than means; Fowler, Cohen & Jarvis, 1999) were used. The analysis of population data was wider than the analysis of individual data because we inc luded some species and populations for whic h DNA sampling and morphometric measurements were made on different plants. We have also analysed correlation from individual data (all species included) for all morphological measurements and nuclear DNA markers, and used recursive partitioning analysis, which is the model-based version of discriminant analysis , describing which character values best predict the existing classification (Breiman et al., 1984). Statistical calculations used the R program, version 1.8 for

RESULTS
DNA
MARKERS

Most D. baltica plants have the A haplotype (the unique combinations of plastid fragment lengths , in this case four, from different regions of the plastid genome, henceforth termed `haplotypes'), which is typical of D. fuchsii (see Appendix), but several populations also contained the E and H haplotypes from D. incarnata. Most plants have more than one ITS allele, with the D. incarnata and D. fuchsii alleles being most common (several samples also ha ve the D. maculata ITS allele). The nuclear microsatellite alleles are also mostly those of D. incarnata (da110, sometimes ds126) and/or D. fuchsii (da114, da118, ds130, ds153). For most population samples, multiple alleles were amplified (see Appendix); putative diploids displayed 12 alleles, and several of the allotetraploids had up to four alleles. Some samples collected as D. fuchsii (a diploid) have 34 alleles, but these plants are in fact `northern tetraploids' ( Shipunov et al., 2004) and are morphologically intermediate between D. maculata and D. fuchsii. Several D. incarnata samples also displayed three alleles; most of them belong to populations 242 and 215, and

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

EVOLUTION OF DACTYLORHIZA BALTICA bear D. fuchsii alleles ds153, and da114da118, respectively. In addition, plants from population 215 have the A plastid haplotype (see below). We can guess that these samples belong to triploids of likely hybrid origin. Although the repeats selected were all in triplets (Table 2), the lengths of the fragments produced indicates that some of the variation we detected occurred in the flanking regions rather than just in the repeats; we did not verify this hypothesis by sequencing some of the variants. Nonetheless, some of the length variants (alleles) detected were diagnostic of the taxa studied, which made them useful markers. Analysis reveals that for nuclear markers overall polymorphism in D. baltica and D. fuchsii is higher than in D. incarnata (F = 2.89 and 2.39, respectively; P < 0.05). The distribution of the nuclear microsatellite alleles is complex, and it is difficult to say which, if any, are typical for the parental taxa. Some are predominant in one species, e.g. da110 in D. incarnata, but then these also show up in other species occasionally (D. fuchsii) and commonly in D. baltica, which is expected since D. baltica has D. incarnata as one of its parents. When they occur in the other parent, they are often associated with the ITS allele of the other species as well, which thus provides two lines of evidence for introgression. Other microsatellite alleles are found in only some populations of one of the parental taxa (e.g. ds153 in some D. fuchsii) and then in some D. incarnata (often again with the D. fuchsii ITS allele) and some D. baltica. Such patterns show that local populations of all species, parental and allotetraploids, are likely to have similar microsatellite alleles. This pattern emerges particularly c learly in the UPGMA analysis (see below).

261

2

4

b

b b bb b b b b b bb b bbb bb b b b

-2

Dim 2 0

b

-4

fuchsii incarnata maculata traunsteineri

b b

-6 -4

-2

0

2 Dim 1

4

6

8

Figure 2. Multidimensional scaling of morphological data from individuals (species highlighted). All points marked with the letter `b' correspond to Dactylorhiza baltica.

MULTIVARIATE

ANALYSES

Both PCA and MDS of the morphological data revealed similar patterns. There are three overlapping groups (Fig. 2) consistent with haplotype and ITS allele distributions and species descriptions ( D. fuchsii + D. maculata; D. baltica and D. incarnata) in general. Plants of the presumed autotetraploid D. maculata were not clearly separated from those of D. fuchsii. Dactylorhiza baltica plants are located not between the two putative parents but rather, are offset to the bottom right-hand corner of the graph. Several plants of D. baltica, however, overlap with the two parental groups. Similar results were obtained by Tyteca & Gathoye (1993) for D. majalis s.s., whereas D. praetermissa samples in their multivariate plot were located directly between the presumed parental species (again, D. fuchsii and D. incarnata). Dactylorhiza baltica plants with haplotypes A and E are distributed closer to D. fuchsii (A haplotype) and

D. incarnata (E haplotype), respectively (not shown). The percentages of the D. incarnata ITS allele vary among D. baltica individuals; plants possessing more copies of this allele are usually located c loser to D. incarnata. Many plants of D. maculata have other haplotypes, B, N or X, which is typical of this species throughout its range. Population-level analysis revealed similar groups (Fig. 3), but for D. baltica, in this case, the offset was less and the diversity greater. We were able to include some additional species in this analysis so it could be seen that British populations of D. praetermissa and D. purpurella were located near the D. baltica points. Addition of other morphological c haracters would be likely to improve the separation of these allotetraploid taxa; the characters we selected were those that appeared to be good for separating D. fuchsii from D. incarnata and D. baltica. A population of D. incarnata ssp. coccinea (Pugsley) SoС from Wales was marginal to the D. incarnata group. In both cases the most important c haracters (which have relatively high loadings in the fi rst component, PC1) are for individuals, plant heights, all leaf characters and inflorescence lengths, and for populations, bract lengths, stem diameters and leaf lengths. Simultaneous analysis of morphology, ITS alleles and nuclear microsatellites produced a less ambiguous structure (Fig. 4), both for individuals and populations (the latter not presented), demonstrating that there is agreement between these kinds of data. An analysis of individuals combining all characters, including the uniparentally inherited plastid

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

262
4

A. P. SHIPUNOV ET AL.
8

99 2

fuchsii incarnata maculata traunsteineri b b b b bb b b

6

PC2 (13.2% of variance) 0 2 4

PC2 (25.6% of variance)

98

216 219 100 218 213 243 111 coccinea fuchsii incarnata maculata praetermissa purpurella traunsteineri 231 18 5 306 304

b b b b bbb b b bb bb b b b

114 0 -2

-4

-6

-4

-2

0

2

4

-4 -8

-2

-6

PC1 (31.0% of variance)

-4 -2 0 PC1 (24.6% of variance)

2

Figure 3. Principal component analysis of the morphological data for populations (species highlighted). All points marked with population numbers correspond to Dactylorhiza baltica.

Figure 5. Simultaneous principal component analysis of all characters (morphology, plastid DNA markers, ITS alleles and nuclear microsatellites) from individuals. All points marked with the letter `b' correspond to Dactylorhiza baltica.

b PC2 (16.5% of variance) 0 2 4 b

fuchsii incarnata maculata traunsteineri b

b b bb bb bb b b bb bb b b b

b bb b

-4

-2

0 2 4 PC1 (19.7% of variance)

6

8

Figure 4. Simultaneous principal component analysis of characters with biparental origin (morphology, ITS alleles and nuclear microsatellites) from individuals. All points marked with the letter `b' correspond to Dactylorhiza baltica.

sequences, changed the picture completely ( Fig. 5). Dactylorhiza baltica specimens were divided into two groups, each corresponding to their contrasting haplotypes and consequently, to their putative maternal parents. Some D. incarnata samples appeared close to

D. fuchsii; these individuals, from population 215, have a D. incarnata morphology, but most have the A haplotype typical of D. fuchsii with a low frequency of the D. incarnata ITS allele. The corresponding analysis of populations generated a similar result (not presented). To represent better some interpopulation relationships and possible geographical patterns, we constructed a UPGMA tree in PAUP for the nuclear DNA data (presence/absence of molecular markers) for populations of D. baltica and its putative parental species. This analysis showed that most D. baltica populations have clear relationships with their putative parents , either D. fuchsii, D. incarnata or even, in some cases, both. The tree (Fig. 6) demonstrates that most D. baltica populations share the same terminal c lusters with nearby populations of D. incarnata and/or D. fuchsii (i.e. from adjacent regions, the same regions, or even the same collection sites). The tree cannot clearly distinguish between D. fuchsii and D. incarnata, but these species have been distinguishable in other molecular analyses (Bateman et al., 2003; Y. Pillon, unpubl. data). The morphological characters formed three correlation groups: (1) most of the vegetative characters, including bract and inflorescence length but not leaf spots, (2) leaf spots and (3) fl oral characters in which the largest significant correlation is between lateral lobe and mid-lobe lengths ( r = 0.83, P << 0.05). The DNA characters most correlated with species parti-

-2

6

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

EVOLUTION OF DACTYLORHIZA BALTICA
fuchsii 19 Sm1 fuchsii 22 Ar1 fuchsii 23 Ar1 fuchsii 30 Mu4 fuchsii 33 Mu4 fuchsii 34 Mu4 fuchsii 10 Tv1 fuchsii 14 Tv2 fuchsii 24 Ar1 fuchsii 35 Mu4 fuchsii 42 Mu2 fuchsii 31 Mu4 fuchsii 90 Mu3 fuchsii 91 Mu3 fuchsii 253 Mu3 fuchsii 9 Tv1 fuchsii 60 Mu4 fuchsii 77 Mo2 traunsteineri 110 Kr1 traunsteineri 130 Mu1 fuchsii 73 Mo2 fuchsii 38 Mu4 fuchsii 92 Mu3 fuchsii 76 Ka1 BALTICA 111 Sm1 fuchsii 305 Mo3 fuchsii 93 Mu3 fuchsii 241 Ka1 fuchsii 321 Mo3 fuchsii 2011 En2 fuchsii 310 Mo3 fuchsii 307 Mo3 BALTICA 99 Or1 fuchsii 12 Tv1 fuchsii 312 Mo3 fuchsii 313 Mo3 fuchsii 206 En2 fuchsii 314 Mo3 fuchsii 41 Mu2 fuchsii 233 Sa4 traunsteineri 78 Mu1 fuchsii 254 Mu3 fuchsii 221 Sa3 fuchsii 222 Sa3 fuchsii 302 Mo3 fuchsii 303 Mo3 BALTICA 304 Mo3 BALTICA 243 Ka1 fuchsii 301 Mo3 incarnata 215 Ps1 fuchsii 308 Mo3 fuchsii 322 Mo3 fuchsii 97 Or1 BALTICA 98 Or1 BALTICA 218 Ps1 BALTICA 231 Sa2 BALTICA 100 Or1 fuchsii 101 Or1 BALTICA 216 Ps1 fuchsii 311 Mo3 incarnata 81 Mo2 praetermissa 201 En2 incarnata 309 Mo3 incarnata 25 Ar1 incarnata 70 Ta1 BALTICA 219 Ps1 fuchsii 325 Tv1 incarnata 252 Mu3 coccinea 2042 En2 incarnata 8 Tv2 incarnata 15 Tv2 incarnata 16 Tv2 BALTICA 18 Sm1 BALTICA 5 Tv1 incarnata 17 Sm1 incarnata 4 Tv1 incarnata 6 Tv1 incarnata 72 Mo2 incarnata 232 Sa4 incarnata 242 Ka1 incarnata 251 Mu3 incarnata 208 Mo2 incarnata 209 Mo2 incarnata 210 Mo2 incarnata 217 Ps1 incarnata 211 Mo2 fuchsii 307 Mo2 BALTICA 213 Sa2 BALTICA 306 Mo3 fuchsii 326 Tv1 fuchsii 40 Mu2

263

Figure 6. UPGMA tree derived from nuclear DNA data of investigated populations. All labels contain the species epithet, population number and code for the collection site (see Fig. 1).
© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

264

A. P. SHIPUNOV ET AL. D. incarnata ITS allele (the plants with less than 3.5% are D. fuchsii), (b) leaf spots (plants with unspotted leaves belong to D. incarnata) and (c) leaf length (plants with leaves shorter than 136 mm are D. baltica). Analysis of the morphological c haracters (misclassification error rate = 8.2%) alone added to this set another character (d): length of the lateral lobes of the lip (plants with lateral lobes less than 2 mm are mostly D. incarnata).

tioning are percentage of D. incarnata ITS alleles, which formed a correlation group (4) with da110 and da118 nuclear microsatellite alleles. This group also has a significant correlation with groups (2) and (3). Recursive partitioning revealed that the three c haracters most important in the analysis of data for D. fuchsii, D. incarnata and D. baltica (Fig. 7; misclassification error rate = 5.2%) were: (a) percentage of

i.inc < 3.5 |

DISCUSSION
The position of D. baltica plants between D. fuchsii and D. incarnata in all analyses provides general support for the hypothesis of origin of D. baltica by hybridization between these two species. Although D. maculata and D. fuchsii are difficult to separate morphometrically, they are clearly distinct on a molecular basis, particularly plastid haplotypes, and it is clear that the markers in D. baltica are those of D. fuchsii and D. incarnata, with occasional markers (ITS alleles and nuclear microsatellites) from D. maculata. Some populations of D. maculata have the A haplotype of D. fuchsii rather than B and other haplotypes related to B that are typical of D. maculata throughout its range (Shipunov et al., 2004; Y. Pillon, unpubl. data). In our sampled plants of D. maculata, the A haplotype is more common than the B haplotype , whereas no sample of D. fuchsii has the B haplotype; so, based purely on the results of our study, we could not clearly state that A is the haplotype of D. fuchsii and B that of D. maculata, although we know this to be the case from other studies. The UPGMA results also demonstrate that D. baltica is related to D. incarnata and D. fuchsii (not D. maculata), but it is clear that in this region the two

LEAF.L < 156.5 fuchsii fuchsii

LEAF.SP < 1.5

i.fuch < 32.5 incarnata incarnata

LEAF.L < 135.5

P.HIGH < 327.5 fuchsii fuchsii baltica

Figure 7. Tree of binary recursive partitioning analysis (a dichotomous key) of morphological and nuc lear DNA characters in the model. The nodes are marked with character codes (see Table 4). Analysis performed on data from individuals of three species (Dactylorhiza incarnata, D. fuchsii and D. baltica).

Table 4. Morphological characters used (all measurements in millimetres) Label P.HIGH LEAF.L LEAF.W L.WPOS LEAF.SP ST.DIAM INFL.L SPUR.L LIP.L LIP.W MIDD.L LATER.L BR.L LIP.COL Description Plant height, from the ground to the top of infl orescence Length of longest leaf Width of longest leaf Position of maximal width (the distance from leaf base to the place of maximal width) Leaf spots (0 none, 1 light, 2 heavy) Stem diameter (measured just above the node of longest leaf) Length from the lowest bract to the top of infl orescence Spur length, measured from lower side of spur Lip length, from the base to the top of middle lobe Lip maximum width Length of middle lobe of the lip, from the base of the sinus to the top apex of lobe Length of lateral lobe of the lip, from the base of the sinus to the top apex of lobe Length of lowermost bract Lip colour (1 white or nearly white, 2 pink, 3 dark pink)

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

EVOLUTION OF DACTYLORHIZA BALTICA species of the D. maculata complex are difficult to distinguish, and pure populations of either are rare . At the same time, the D. baltica points are offset in all graphs, as if some independent evolution of this hybrid has occurred and is refl ected in a morphological bias. HedrИn et al. (2001) also noticed in their AFLP study the same type of offset pattern for Dactylorhiza allotetraploids relative to their putative parents . It is also possible that this offset pattern could be gener ated by introgression from another (or other) species , but we favour the former explanation because we do not find markers of any other species of Dactylorhiza in D. baltica; Y. Pillon (unpubl. data) examined haplotype and ITS alleles for a complete set of European species, and we know which markers these other species exhibit. In the investigation of Tyteca & Gathoye (1993), allotetraploid D. majalis s.s. has the same position relative to its presumed parents in the graph, but in this case, we have evidence of some unique markers (notably, the C haplotype) in this species ( Y. Pillon, unpubl. data). On other hand, Kulikov & Filippov (1999a) observed that a southern Siberian (2 n = 40) diploid (and probably recent) hybrid between D. incarnata and D. fuchsii (D. Ґ intermedia (Serg.) Kulikov et Filippov) has a distinct position in multivariate morphological analyses of these species , despite many morphological similarities to D. baltica. Additionally, the position of some long-recorded D. baltica populations (213 and 218, both homogeneous in nuclear markers) are placed exactly between the parents (Fig. 3). Therefore, the presence or absence of the offset cannot distinguish between primary hybrids and stable hybrid species. The uniparentally inherited plastid markers are able to distinguish among `ordinary' nonhybrid species ( Shipunov et al., 2004), and they also reveal multiple origins of allotetraploids such as D. baltica because most populations investigated contain at least two haplotypes (see Appendix). Several D. baltica plants and populations are embedded in the D. fuchsii or (less often) D. incarnata groups in the multivariate analyses (Figs 25), which could be evidence of backcrossing of D. baltica and introgression. Occurrence of introgression between D. incarnata and D. fuchsii is supported by finding the D. incarnata ITS allele in some true D. fuchsii plants (and sometimes vice versa) from neighbouring populations. Introgression from D. maculata into D. baltica is less likely to occur, but in a few cases we found D. maculata ITS and microsatellite alleles in individuals of D. baltica (see Appendix). It is likely that these cases occur because of hybridization between D. maculata and D. fuchsii, which then subsequently permits the D. maculata markers to enter D. baltica; in no case did we find any unique D. maculata haplotypes (B, N or X) in D. baltica, and the frequency of other typical

265

D. maculata DNA markers was low compared with those of D. incarnata and D. fuchsii. Although D. maculata and D. fuchsii are often considered morphologically similar, in other studies (especially in western and north-western Europe) they ha ve been shown to be separable with morphometric and molecular approaches (Bateman & Denholm, 2003; Y. Pillon, unpubl. data). Here, the selected morphometric measures that separate D. fuchsii, D. incarnata and D. baltica are less effective in separating D. maculata from D. fuchsii. This observation could also be explained by hybridization and likely introgression between these species, especially in northern Russia (Shipunov et al., 2004) where most of the overlapping samples originated and allotetraploids formed by these two species occur in large populations . Exchange of alleles/haplotypes between the parental diploids is consistent with the allotetraploids forming a `bridge' for gene flow between the two diploids. There is also some correlation between the proportion of D. incarnata ITS allele (determined from the peak height in the PCR of the length-variable ITS fragments) in D. baltica plants and their morphology, which could be explained by backcrossing with D. incarnata. Some D. baltica samples (especially from north-western populations) lac k or have only a small proportion of D. fuchsii (da114 or da118) nuclear microsatellite alleles, which again could be evidence of backcrossing. The D. incarnata plants from populations 210 and 215 with the A haplotype fall into the D. fuchsii group in the combined analysis ( Fig. 5); this situation could result from a solitary introgression event, leading in particular to `plastid capture' (Jackson et al., 1999) of the D. fuchsii plastid genome. It is also possible that some of the D. baltica individuals are primary, diploid hybrids between D. fuchsii and D. incarnata, which would mean that exchange is taking place directly rather than through allotetraploids . It is easier to imagine that D. baltica is acting as a bridge because the flowering periods of D. fuchsii (late) and D. incarnata (early) have little overlap whereas D. baltica overlaps both because it is intermediate. We do not know the frequencies of diploids, triploids and tetraploids in D. baltica populations, so we cannot say that it is the allotetraploids that are the conduit for the introgression that we detected, but this seems most likely. If triploids formed by crosses between D. baltica and either D. fuchsii or D. incarnata produce some diploid gametes, then these could lead to the introgression we detected in both D. fuchsii and D. incarnata. Some of the plants identified as D. incarnata had three microsatellite alleles, which means that these are likely to be triploids. Some of these individuals were also morphologically more similar to D. baltica, which also supports their status as backcrosses between

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

266

A. P. SHIPUNOV ET AL. across its range. We hope that by developing more microsatellite loci we can dissect the variation in D. incarnata and D. fuchsii and thus understand better the intriguing variation in morphology and ecology observed in the allotetraploids. The geographical patterns refl ected in the UPGMA tree of nuclear DNA data (Fig. 6) provide additional evidence for the hypothesis of multiple origins of these tetraploids (the probability of these plants being triploids is low because most of our D. baltica samples represent homogeneous populations). Plants of D. baltica associate with nearby populations of one of its two parental taxa, and these could be similar to (or even be) the parents of the D. baltica populations. These origins might thus be local, and perhaps even restricted to the area of the collection sites (typically around 100500 km2). The alternative explanation for these patterns is that all plants from the localities cluster together because they share alleles due to local hybridization and introgression. Distinguishing between these alternate explanations is diffi cult. The analyses of character loading, correlation and regression trees (Fig. 7) support the main morphological characters used in Dactylorhiza classification, especially in recent morphometric studies ( Bateman & Denholm, 1983, 1985, 1989, 2003; Reinhard, 1990; Tyteca & Gathoye, 1993). The result of the character analysis led us to propose that identifi cation of D. baltica is possible from single, unmodified characters such as leaf spots, length of longest leaf and length of lateral lip lobes; all of these characters are mentioned as diagnostic in Table 1 and yield the highest loadings in our PCA (Figs 35). The correlation groups also demonstrate the relative independence of floral characters, leaf spots and the rest of the vegetative characters measured. Our study displays the good agreement between the results of simultaneous molecular and morphometric analyses, which demonstrates the advantage of `combined' techniques, especially in cases of complex taxa with frequent hybridization and/ or introgression.

D. baltica and D. incarnata. Such individuals will have two doses of the D. incarnata genome, which means that they should be morphologically more similar to D. incarnata rather than to D. baltica, resulting in their identifi cation as D. incarnata. Orchids in general, including Dactylorhiza, produce thousands of ovules, and fertilization involves deposition of large parts, often whole masses of pollen, so even though diploid gametes might be rare in triploids, they could be common enough for this route to be effective in producing introgression. Further evidence of introgression involving the allotetraploids is found in the UPGMA results, which show geographical clusters of all taxa sharing nuc lear microsatellite markers unique to that region ( Fig. 6). There is some evidence of the association between D. baltica, D. praetermissa and D. purpurella that supports Averyanov's (1990) classification of Dactylorhiza, but this conclusion needs clearer support from more thorough sampling of these taxa. On the other hand, D. praetermissa (north-western and western Europe) differs from D. baltica in its high frequency of an ITS allele never found in D. fuchsii or D. incarnata but sometimes found in D. saccifera (Brongn.) SoС from south-eastern Europe (Italy, Greece) through to Turkey (Y. Pillon, unpubl. data). Like D. baltica, D. purpurella also has multiple (and probably recent) origins from D. incarnata and D. fuchsii (Y. Pillon, unpubl. data). Another allotetraploid found in eastern Europe is D. traunsteineri, but our data are insuffi cient for a genetic comparison with D. baltica. If the various allotetraploids that ha ve been consistently recognized are the products of repeated crosses between the same two parental species, it becomes difficult to understand how their morphological and sometimes ecological differences ha ve arisen. For example, we see in this study that the Russian D. fuchsii plants bear the same haplotype and ITS alleles as those in western Europe (Y. Pillon, unpubl. data). Nonetheless, the differences observed between allotetraploid species with same species-level parentage could be based on geographical variability of the parents, most importantly D. incarnata. This species has the E haplotype in western Europe , whereas many Russian samples of D. incarnata have the H haplotype (Shipunov et al., 2004). Despite clear morphological variability, D. incarnata has previously been found to be highly genetically uniform in most allozymes and AFLPs studies (HedrИn et al., 2001; HedrИn, 2002, 2003), whereas D. fuchsii has been more variable locally, although a similar spread of variation occurs throughout the range of the latter species. On the other hand, D. incarnata has a considerable range of morphological variation and more named varieties than D. fuchsii; thus, we suspect that the distinctiveness of the allotetraploids is a result of this variation

ACKNOWLEDGEMENTS
We are grateful to all the colleagues and friends who helped us in collection of Dactylorhiza plant material and morphometric data: L. Abramova, Zh. Altshuler, I. Blinova, T. Braslavskaja, S. Glagolev, N. Guryanova, A. Karjakin, G. Konechnaja, J. Kosenko, E. Kost, I. Kucherov, A. Kvashenko, M. Logacheva, K. Markvicheva, S. Nazarova, A. Pegova, E. Peskova, S. Polevova, N. Reshetnikova, N. Rimskaja-Korsakova, N. Sajtanova, A. Shipunova, A. Skorobogatov, D. Sokoloff, S. Suhov, D. Suhova, M. Vakhrameeva, T. Vinogradova, P. Volkova, T. Vorozhbieva and I. Yufrjakov. We also thank R. Cowan, L. Csiba, J. Clarkson, E.

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

EVOLUTION OF DACTYLORHIZA BALTICA Kapinos and Y. Pillon for their valuable help and advice with the laboratory and computer analyses , and R. Bateman for his many comments on the manuscript during review. This work was supported by the Royal Society of London and sponsored by NA TO and the British Foreign and Commonwealth Offi ce.

267

REFERENCES
Averyanov LV. 1990. A review of genus Dactylorhiza Neck. ex Nevski (Orchidaceae), 3 [in Russian]. Novosti Sistematiki Vysshikh Rastenij 27: 3262. Bateman RM. 2001. Evolution and classification of European orchids: insights from molecular and morphological characters. Journal EuropДischer Orchideen 33: 33119. Bateman RM, Denholm I. 1983. A reappraisal of the British and Irish dactylorchids, 1. The tetraploid marsh-orchids. Watsonia 14: 347376. Bateman RM, Denholm I. 1985. A reappraisal of the British and Irish dactylorchids, 2. The diploid marsh-orchids. Watsonia 15: 321355. Bateman RM, Denholm I. 1989. A reappraisal of the British and Irish dactylorchids, 3. The spotted-orchids. Watsonia 17: 319349. Bateman RM, Denholm I. 2003. The heath spotted-orchid (Dactylorhiza maculata (L.) (SoС) in the British Isles: a cautionary case-study in delimiting infraspecific taxa and inferring their evolutionary relationships. Journal EuropДischer Orchideen 35: 336. Bateman RM, Hollingsworth PM, Preston J, Luo YB, Pridgeon AM, Chase MW. 2003. Molecular phylogenetics and evolution of Orchidinae and selected Habenariinae (Orchidaceae). Botanical Journal of the Linnean Society 142: 140. Brachet S, Jubier MF, Richard M, Jung-Muller B, Frascaria-Lacoste N. 1999. Rapid identification of microsatellite loci using 5ў-anchored PCR in the common ash Fraxinus excelsior. Molecular Ecology 8: 157168. Breiman L, Friedman JH, Olshen RA, Stone CJ. 1984. Classification and regression trees. New York: Chapman & Hall. Chase MW, Hills HG. 1991. Silica gel: an ideal material for field preservation of leaf samples for DNA studies. Taxon 40: 215220. Chase MW, Knapp S, Cox AV, Clarkson JJ, Butsko Y, Joseph J, Savolainen V, Parokonny AS. 2003. Molecular systematics, GISH and the origin of hybrid taxa in Nicotiana (Solanaceae). Annals of Botany 92: 107127. Delforge P. 1995. Orchids of Britain and Europe. London: Harper Collins. Devos N, Tyteca D, RaspИ O, Wesselingh RA, Jacquemart AL. 2003. Patterns of chloroplast diversity among western European Dactylorhiza species (Orchidaceae). Plant Systematics and Evolution 243: 8597. Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of leaf tissue. Phytochemical Bulletin 19: 1115.

Fisher PJ, Gardner RC, Richardson TE. 1996. Single locus microsatellites isolated using 5ў-anchored PCR. Nucleic Acids Research 24: 43694371. Fowler J, Cohen L, Jarvis P. 1999. Practical statistics for field biology. 2nd edn. Chichester: John Wiley & Sons. HedrИn M. 2002. Speciation patterns in the Dactylorhiza incarnata/maculata polyploid complex (Orchidaceae): evidence from molecular markers. Journal EuropДischer Orchideen 34: 707731. HedrИn M. 2003. Plastid DNA variation in the Dactylorhiza incarnata/maculata polyploid complex and the origin of allotetraploid D. sphagnicola (Orchidaceae). Molecular Ecology 12: 26692680. HedrИn M, Fay MF, Chase MW. 2001. Amplified fragment length polymorphisms (AFLP) reveal details of polyploid evolution in Dactylorhiza (Orchidaceae). American Journal of Botany 88: 18681880. Heslop-Harrison J. 1968. Genetic system and ecological habit as factors in dactylorchid variation. Jahresberichte des Naturwissenschaftlichen Vereins in Wuppertal 2122: 20 27. Jackson HD, Steane DA, Potts BM, Vaillancourt RE. 1999. Chloroplast DNA evidence for reticulate evolution in Eucalyptus (Myrtaceae). Molecular Ecology 8: 739751. Klinge J. 1895. Orchis latifolia subsp. baltica. In: Lehmann E, ed. Flora von Polnisch-Livland. Jurjew: C. Mattiensen, 188. Klinge J. 1898. Dactylorchidis, orchidis subgeneris, monographiae prodromus. Acta Horti Petropolitani 17: 56. Kulikov PV, Filippov EG. 1999a. Dactylorhiza baltica (Klinge) Orlova complex (Orchidaceae) in the Urals and western Siberia. Bulletin of the Moscow Society of Naturalists, Biological Series 104: 2933. Kulikov PV, Filippov EG. 1999b. Dactylorhiza aggr. traunsteineri (Saut.) SoС complex (Orchidaceae) in the Urals: taxonomic structure and distribution. Bulletin of the Moscow Society of Naturalists, Biological Series 104: 6165. Nevski SA. 1935. Orchidaceae Lindl. In: Komarov VL, ed. Flora USSR. Vol. 4. Leningrad: Academy of Science Publisher, 589730. Reinhard HR. 1990. Kritische Anmerkungen zu Einigen Dactylorhiza-Arten (Orchidaceae) Europas. Mitteilungsblatt AHO Baden-WЭrttemberg 22: 172. Senghas K. 1968. Taxonomische Ubersicht der Gattung Dactylorhiza Necker ex Nevski. Jahresberichte des Naturwissenschaftlichen Vereins in Wuppertal 2122: 3267. Shipunov AB, Fay MF, Pillon Y, Bateman RM, Chase MW. in press. Dactylorhiza (Orchidaceae) in European Russia: combined molecular and morphological analysis. American Journal of Botany in press. Smoljaninova LA. 1976. Dactylorhiza Nevski [in Russian]. Flora Evropejskoj Chasti SSSR 2: 4957. SoС R. 1980. Dactylorhiza Necker ex Nevski. In: Tutin TG, Heywood VH, Burges NA, Moore DM, Valentine DH, Walters SM, Webb DA, eds. Flora Europaea. Vol. 5. Cambridge: Cambridge University Press, 333337. Stace CA. 1997. New flora of the British Isles 2nd edn. Cambridge: Cambridge University Press.

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

268

A. P. SHIPUNOV ET AL.
Venables WN, Smith DN, the R Development Core Team. 2002. An introduction to R. Bristol: Network Theory Ltd. Vermeulen P. 1947. Studies in dactylorchids. Utrecht: Schotanus and Jens.

Swofford DL. 2000. PAUP*: phylogenetic analysis using parsimony, Version 4.0. Washington, D.C.: Smithsonian Institution Tyteca D, Gathoye JL. 1993. On the morphological variability of Dactylorhiza praetermissa (Druce) SoС (Orchidaceae). Belgian Journal of Botany 126: 8199.

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

APPENDIX 1

Dactylorchid populations sampled for use in at least one type of analysis Collection site Locality

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

Species

Population(s)

EVOLUTION OF DACTYLORHIZA BALTICA

baltica baltica baltica baltica baltica baltica baltica baltica baltica fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata

5 18 98100 111 114, 213 216219 231 243 304, 306 9, 10, 12, 325331 14, 334 19 2224 30, 31, 3335, 60 73 76, 241 77 101 133 206 212 221, 222 302, 303, 305, 307, 308, 310314, 321, 322 2011 4, 6, 7 8, 15, 16, 323, 332, 333 17 25 70 72, 209211 71 81 215 232 242 251, 252 309

Middle Russia, Tver' region (Tv) Middle Russia, Smolensk region (Sm) Middle Russia, Orel region (Or) Middle Russia, Smolensk region (Sm) North-west Russia, St Petersburg region (Sa) North-west Russia, Pskov region (Ps) North-west Russia, St Petersburg region (Sa) Middle Russia, Kaluga region (Ka) Middle Russia, Moscow region (Mo) Tv Tv Sm Northern Russia, Archangelsk region Northern Russia, Northern Karelia Mo Ka Mo Or Northern Russia, Murmansk region England Sa Sa Mo Wales Tv Tv Sm Northern Russia, Archangelsk region Middle Russia, Tambov region Mo Mo Mo Ps Sa Ka Northern Russia, Murmansk region Mo

Udomlja District, Lake Moldino environs Przheval'sk District, Lake Chistik environs Znamenskoe District, Vytebet' River environs Demidov District, Lake Rzhavez environs St Petersburg (in the city) Sebezh District St. Petersburg, Strel'na settlement Kozel'sk district, Zhizdra River environs Volokolamsk District Udomlja District, Lake Moldino environs Vyshnij Volochek District, Lake Ol'shevo environs Przheval'sk District, Lake Chistik environs Ust'jansk District Chupa District Odintsovo District Kozel'sk district, Zhizdra River environs Ruza District Znamenskoe District, Vytebet' River environs Kirovsk District Avon, Bristol Primorsk District Volhov District Volokolamsk District South Glamorgan Udomlja District, Lake Moldino environs Vyshnij Volochek District, Lake Ol'shevo environs Przheval'sk District, Lake Chistik environs Ust'jansk District Pervomajsk District Odintsovo District Taldom District Ruza District Sebezh District Gatchina District Kozel'sk district, Zhizdra River environs Kandalaksha District Volokolamsk District

269

270

APPENDIX 1 Continued
Collection site Locality

A. P. SHIPUNOV ET AL.

Species

Population(s)

Russia, Russia, Russia, Russia, Russia, Murmansk region

Archangelsk region Northern Karelia Murmansk region Murmansk region

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

incarnata ssp. coccinea maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata praetermissa praetermissa praetermissa purpurella traunsteineri traunsteineri Wales Tv Sm Northern Norhtern Northern Northern Mo Northern England England England Wales Ps Sa Sa Northern Wales Wales Wales Wales Northern Northern Russia, Murmansk region Russia, Murmansk region Russia, Karelia

2042 13, 324 20 21 32, 36, 37, 39, 4750, 257, 258 4046 9094 74, 75 79, 60, 130, 132 197 198 200 203 214 223, 224 233 253, 254, 256 201 202 204, 205 204, 205 78, 131 110

Dyfed, Ynyslas Udomlja District, Lake Moldino environs Przheval'sk District, Lake Chistik environs Ust'jansk District Chupa District Kandalaksha District Chupa District Odintsovo District Kirovsk District Cornwall, Traboe Moors Cornwall, The Lizard Cumbria, Duddon Valley Dyfed, Cors Fochno Sebezh District Sosnovyj Bor District Pavlovsk Kandalaksha District South Glamorgan Carmarthenshire Dyfed, Ynyslas Dyfed, Ynyslas Kirovsk District Onego Lake District

APPENDIX 2

Combinations of plastid haplotypes, ITS DNA alleles (Y. Pillon, unpubl. data; Shipunov et al., 2004) and nuclear microsatellite alleles from individuals. Populations with plants of the same haplotypes and alleles are listed in a single row, whereas polymorphic populations occupy only two or more rows ITS alleles Haplotype i.fuch Nuclear microsatellites

i.inc

i.mac1

i.mac2

i.mac3 da103

da110

da114

da118

da120

da126

da130

da132

da136

da140

da143

da144

da147

da150 + +

Species A A A A A A A E E E E A A A A E A A A A A A + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + A E A A A A A RU1 A Q

Population(s)

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica baltica

EVOLUTION OF DACTYLORHIZA BALTICA

, , ,, ,

fuchsii fuchsii fuchsii fuchsii, incarnata

+ + + + + +

+ +

+

+ + + + + +

+

+

baltica, maculata coccinea fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii

5 18 98 98, 213, 9485 98 111 213 216 216, 218 219 219 243 243 243 243 243 304 306 100, 101, 311 219, 325 243, 301 97, 98, 100, 208, 210, 231 94, 99, 131 2042 9, 91 12, 90 12, 312 19, 22, 23, 33, 34 19 30 31 38

+ + + +

da153 + + + + + +

271

272

APPENDIX 2 Continued
ITS alleles Haplotype i.fuch Nuclear microsatellites

i.inc

i.mac1

i.mac2

i.mac3 da103

da110

da114

da118

da120

da126

da130

da132

da136

da140

da143

da144

da147

da150

A. P. SHIPUNOV ET AL.
da153 + + + + + + + + + + + +

Species 40 40 41 60 73 76 77, 91 77, 92 90 90 90 90 92 92 93 97 206 207 210 221, 222 233 241 241 241, 310 241 241 253 254 302 303 305 307 308 313 314 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + A A A Q Q Q A A A A A A A A A A A A Q A A A A A A A Q A A Q RU1 A A A Q + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

Population(s)

fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii fuchsii

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

ITS alleles Haplotype i.fuch

Nuclear microsatellites

i.inc

i.mac1

i.mac2

i.mac3 da103

da110

da114

da118

da120

da126

da130

da132

da136

da140

da143

da144

da147

da150 + + + + + + + + + + + +

Species 322 326 2011 92, 215 10, 14, 19, 24, 32, 35, 42, 92 36, 90 37, 321 43, 93 45, 93 49, 97 79, 241 80, 91 90, 214, 241 92, 94 91, 92, 130 4, 6, 232, 242, 251 8, 15, 16 8 17 25 70 72, 208, 210 81, 309 209 210 210, 211 215 215 215 215 217 232, 242 232 252 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + A A A A A A A A A A E E E E E H H E H E H A A A A E E H E A A A A A + + +

Population(s)

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274

fuchsii fuchsii fuchsii fuchsii, incarnata fuchsii, maculata

fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, maculata fuchsii, traunsteineri incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata incarnata

da153

EVOLUTION OF DACTYLORHIZA BALTICA

273

APPENDIX 2 Continued
ITS alleles Haplotype i.fuch Nuclear microsatellites

274

i.inc

i.mac1

i.mac2

i.mac3 da103

da110

da114

da118

da120

da126

da130

da132

da136

da140

da143

da144

da147

da150

A. P. SHIPUNOV ET AL.
da153 + + + + + + + + + + + + + + + + + + + + + +

Species 301 11 11 13 13 20 20 21 39 50 71 74 75 132 200 203 212 212 214 214 214 214 214 214 214 214 214 214 216 223 224 224 324 201 78 110 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + E B B B B X X A A A B N A A B B A A A A A A B B N N N N X A A A N A A A + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

Population(s)

incarnata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata maculata praetermissa traunsteineri traunsteineri

© 2005 The Linnean Society of London, Botanical Journal of the Linnean Society, 2005, 147, 257 274