Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~ivyura/Term3/files/megablastres.txt Дата изменения: Sun Oct 7 14:20:47 2007 Дата индексирования: Tue Oct 2 19:04:09 2012 Кодировка:

MEGABLAST 2.2.15 [Oct-15-2006]


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
"A greedy algorithm for aligning DNA sequences",
J Comput Biol 2000; 7(1-2):203-14.

Database: ss
272 sequences; 3,008,365 total letters

Searching..................................................done

Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome.
(76 letters)



Score E
Sequences producing significant alignments: (bits) Value

AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section ... 32 0.038
AE006765 AE006641 |AE006765| Sulfolobus solfataricus P2 section ... 26 2.3
AE006751 AE006641 |AE006751| Sulfolobus solfataricus P2 section ... 26 2.3
AE006716 AE006641 |AE006716| Sulfolobus solfataricus P2 section ... 26 2.3
AE006824 AE006641 |AE006824| Sulfolobus solfataricus P2 section ... 24 9.1
AE006818 AE006641 |AE006818| Sulfolobus solfataricus P2 section ... 24 9.1
AE006816 AE006641 |AE006816| Sulfolobus solfataricus P2 section ... 24 9.1
AE006778 AE006641 |AE006778| Sulfolobus solfataricus P2 section ... 24 9.1
AE006756 AE006641 |AE006756| Sulfolobus solfataricus P2 section ... 24 9.1
AE006748 AE006641 |AE006748| Sulfolobus solfataricus P2 section ... 24 9.1
AE006738 AE006641 |AE006738| Sulfolobus solfataricus P2 section ... 24 9.1
AE006719 AE006641 |AE006719| Sulfolobus solfataricus P2 section ... 24 9.1
AE006690 AE006641 |AE006690| Sulfolobus solfataricus P2 section ... 24 9.1
AE006658 AE006641 |AE006658| Sulfolobus solfataricus P2 section ... 24 9.1

>AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section 5 of
272 of the complete genome.
Length = 7990

Score = 32.2 bits (16), Expect = 0.038
Identities = 19/20 (95%)
Strand = Plus / Plus


Query: 8 tagctcagttggtagagcgc 27
|||||||||||| |||||||
Sbjct: 7723 tagctcagttggcagagcgc 7742


>AE006765 AE006641 |AE006765| Sulfolobus solfataricus P2 section 124
of 272 of the complete genome.
Length = 10284

Score = 26.3 bits (13), Expect = 2.3
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 32 ttggtaagggtga 44
|||||||||||||
Sbjct: 7379 ttggtaagggtga 7391


>AE006751 AE006641 |AE006751| Sulfolobus solfataricus P2 section 110
of 272 of the complete genome.
Length = 10129

Score = 26.3 bits (13), Expect = 2.3
Identities = 13/13 (100%)
Strand = Plus / Minus


Query: 13 cagttggtagagc 25
|||||||||||||
Sbjct: 6887 cagttggtagagc 6875


>AE006716 AE006641 |AE006716| Sulfolobus solfataricus P2 section 75 of
272 of the complete genome.
Length = 13396

Score = 26.3 bits (13), Expect = 2.3
Identities = 13/13 (100%)
Strand = Plus / Plus


Query: 8 tagctcagttggt 20
|||||||||||||
Sbjct: 8403 tagctcagttggt 8415


>AE006824 AE006641 |AE006824| Sulfolobus solfataricus P2 section 183
of 272 of the complete genome.
Length = 13389

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Plus


Query: 33 tggtaagggtga 44
||||||||||||
Sbjct: 8077 tggtaagggtga 8088


>AE006818 AE006641 |AE006818| Sulfolobus solfataricus P2 section 177
of 272 of the complete genome.
Length = 10370

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 26 gcacccttggta 37
||||||||||||
Sbjct: 2223 gcacccttggta 2212


>AE006816 AE006641 |AE006816| Sulfolobus solfataricus P2 section 175
of 272 of the complete genome.
Length = 10029

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Plus


Query: 57 gaatctgcctat 68
||||||||||||
Sbjct: 3802 gaatctgcctat 3813


>AE006778 AE006641 |AE006778| Sulfolobus solfataricus P2 section 137
of 272 of the complete genome.
Length = 10554

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 14 agttggtagagc 25
||||||||||||
Sbjct: 693 agttggtagagc 682


>AE006756 AE006641 |AE006756| Sulfolobus solfataricus P2 section 115
of 272 of the complete genome.
Length = 10275

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 62 tgcctatcagca 73
||||||||||||
Sbjct: 6142 tgcctatcagca 6131


>AE006748 AE006641 |AE006748| Sulfolobus solfataricus P2 section 107 of
272 of the complete genome.
Length = 11753

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 61 ctgcctatcagc 72
||||||||||||
Sbjct: 11021 ctgcctatcagc 11010


>AE006738 AE006641 |AE006738| Sulfolobus solfataricus P2 section 97 of
272 of the complete genome.
Length = 10444

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 5 atatagctcagt 16
||||||||||||
Sbjct: 4979 atatagctcagt 4968


>AE006719 AE006641 |AE006719| Sulfolobus solfataricus P2 section 78 of
272 of the complete genome.
Length = 13191

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Plus


Query: 1 gctgatatagct 12
||||||||||||
Sbjct: 10461 gctgatatagct 10472


>AE006690 AE006641 |AE006690| Sulfolobus solfataricus P2 section 49 of
272 of the complete genome.
Length = 10261

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Minus


Query: 1 gctgatatagct 12
||||||||||||
Sbjct: 8339 gctgatatagct 8328


>AE006658 AE006641 |AE006658| Sulfolobus solfataricus P2 section 17 of
272 of the complete genome.
Length = 11648

Score = 24.3 bits (12), Expect = 9.1
Identities = 12/12 (100%)
Strand = Plus / Plus


Query: 56 cgaatctgccta 67
||||||||||||
Sbjct: 9724 cgaatctgccta 9735


Database: ss
Posted date: Oct 7, 2007 12:18 PM
Number of letters in database: 3,008,365
Number of sequences in database: 272

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 272
Number of Hits to DB: 5308
Number of extensions: 227
Number of successful extensions: 14
Number of sequences better than 10.0: 14
Number of HSP's gapped: 14
Number of HSP's successfully gapped: 14
Length of query: 76
Length of database: 3,008,365
Length adjustment: 14
Effective length of query: 62
Effective length of database: 3,004,557
Effective search space: 186282534
Effective search space used: 186282534
X1: 11 (21.8 bits)
X2: 20 (39.6 bits)
X3: 51 (101.1 bits)
S1: 12 (24.3 bits)
S2: 12 (24.3 bits)