BLASTN 2.2.15 [Oct-15-2006]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= D85081 D85081.1 Escherichia coli gene, replication terminus
region, partial and complete cds.
(606 letters)
Database: 3g
884 sequences; 12,243,887 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section... 293 2e-79
AE012230 AE008922 |AE012230| Xanthomonas campestris pv. campestr... 34 0.37
AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestr... 34 0.37
AE008759 AE006468 |AE008759| Salmonella typhimurium LT2, section... 34 0.37
AE008695 AE006468 |AE008695| Salmonella typhimurium LT2, section... 34 0.37
AE012370 AE008922 |AE012370| Xanthomonas campestris pv. campestr... 32 1.4
AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestr... 32 1.4
AE008833 AE006468 |AE008833| Salmonella typhimurium LT2, section... 32 1.4
AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section... 32 1.4
AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section... 32 1.4
embl|AE006188|AE006188 Pasteurella multocida subsp. multocida st... 30 5.7
embl|AE006187|AE006187 Pasteurella multocida subsp. multocida st... 30 5.7
embl|AE006075|AE006075 Pasteurella multocida subsp. multocida st... 30 5.7
embl|AE006061|AE006061 Pasteurella multocida subsp. multocida st... 30 5.7
AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestr... 30 5.7
AE012429 AE008922 |AE012429| Xanthomonas campestris pv. campestr... 30 5.7
AE012406 AE008922 |AE012406| Xanthomonas campestris pv. campestr... 30 5.7
AE012398 AE008922 |AE012398| Xanthomonas campestris pv. campestr... 30 5.7
AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestr... 30 5.7
AE012280 AE008922 |AE012280| Xanthomonas campestris pv. campestr... 30 5.7
AE012254 AE008922 |AE012254| Xanthomonas campestris pv. campestr... 30 5.7
AE012243 AE008922 |AE012243| Xanthomonas campestris pv. campestr... 30 5.7
AE012189 AE008922 |AE012189| Xanthomonas campestris pv. campestr... 30 5.7
AE012162 AE008922 |AE012162| Xanthomonas campestris pv. campestr... 30 5.7
AE012098 AE008922 |AE012098| Xanthomonas campestris pv. campestr... 30 5.7
AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section... 30 5.7
AE008856 AE006468 |AE008856| Salmonella typhimurium LT2, section... 30 5.7
AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section... 30 5.7
AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section... 30 5.7
AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section... 30 5.7
AE008741 AE006468 |AE008741| Salmonella typhimurium LT2, section... 30 5.7
AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section... 30 5.7
>AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section 76 of
220 of the complete genome.
Length = 20609
Score = 293 bits (148), Expect = 2e-79
Identities = 339/400 (84%), Gaps = 2/400 (0%)
Strand = Plus / Plus
Query: 1 atgagcaaggtattagttcttaaatccagcatcctggcagggtactctcagtctaatcag 60
||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||
Sbjct: 16106 atgagcaaggtattagttcttaaatccagtattctggcagggtactctcagtctggtcag 16165
Query: 61 ttgtc-gattattttgttgaacaatggcgcgaaaagcactccgcgtgatgaaatcaccgt 119
||| | || |||||| ||||||||||||||||||| ||| ||| |||||||| || ||
Sbjct: 16166 ttgactgactattttattgaacaatggcgcgaaaaacacgtcgca-gatgaaattactgt 16224
Query: 120 tcgcgacctggctgcaaatccgattccggtactggatggcgaactggttggcgctctgcg 179
||||| ||||| || || || ||||||| ||||||||||| ||||| ||||| ||||
Sbjct: 16225 ccgcgatctggcggccaaccctgttccggtgctggatggcgagctggtgggcgcgatgcg 16284
Query: 180 tccgagcgatgcgccgctgactccgcgtcagcaggaagctctggcactttccgatgagtt 239
|||| |||||||||| | || || ||||||||||| |||||||| || || ||||| |
Sbjct: 16285 tccgggcgatgcgcctttaacgccacgtcagcaggacgctctggcgctgtctgatgaact 16344
Query: 240 gattgccgagctgaaagcccacgacgttatcgttattgcggcaccgatgtataacttcaa 299
||||| || ||||||||||||||||| |||||||||||||| |||||||| || |||||
Sbjct: 16345 cattgctgaactgaaagcccacgacgtcatcgttattgcggcgccgatgtacaatttcaa 16404
Query: 300 catctcgactcagttgaaaaactattttgacctggttgcccgcgcaggcgttactttccg 359
||| |||| ||| |||||||||| ||||| ||| |||||||||| || | ||||||||
Sbjct: 16405 tatcccgacgcagctgaaaaactactttgatctgattgcccgcgccggtatcactttccg 16464
Query: 360 ctataccgagaacggtccggaaggtctggtaacgggtaaa 399
||||||||| || || ||||||||||||||||| ||||||
Sbjct: 16465 ctataccgaaaaaggcccggaaggtctggtaaccggtaaa 16504
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 569 acgcaaaagcagccat 584
||||||||||||||||
Sbjct: 3410 acgcaaaagcagccat 3395
>AE012230 AE008922 |AE012230| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 138 of 460 of the complete
genome.
Length = 10813
Score = 34.2 bits (17), Expect = 0.37
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 415 accagccgcggcgggat 431
|||||||||||||||||
Sbjct: 6668 accagccgcggcgggat 6652
>AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestris str.
ATCC 33913, section 12 of 460 of the complete genome.
Length = 12966
Score = 34.2 bits (17), Expect = 0.37
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 151 ctggatggcgaactggt 167
|||||||||||||||||
Sbjct: 10214 ctggatggcgaactggt 10230
>AE008759 AE006468 |AE008759| Salmonella typhimurium LT2, section 63
of 220 of the complete genome.
Length = 20279
Score = 34.2 bits (17), Expect = 0.37
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 495 cattaccgatgtgaaat 511
|||||||||||||||||
Sbjct: 8449 cattaccgatgtgaaat 8433
>AE008695 AE006468 |AE008695| Salmonella typhimurium LT2, section 3 of
220 of the complete genome.
Length = 23563
Score = 34.2 bits (17), Expect = 0.37
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 239 tgattgccgagctgaaa 255
|||||||||||||||||
Sbjct: 9554 tgattgccgagctgaaa 9538
>AE012370 AE008922 |AE012370| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 278 of 460 of the complete
genome.
Length = 13098
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 416 ccagccgcggcgggat 431
||||||||||||||||
Sbjct: 3823 ccagccgcggcgggat 3838
>AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 13 of 460 of the complete
genome.
Length = 11990
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 179 gtccgagcgatgcgcc 194
||||||||||||||||
Sbjct: 7797 gtccgagcgatgcgcc 7812
>AE008833 AE006468 |AE008833| Salmonella typhimurium LT2, section 137 of
220 of the complete genome.
Length = 20984
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 367 gagaacggtccggaag 382
||||||||||||||||
Sbjct: 11256 gagaacggtccggaag 11241
>AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section 119
of 220 of the complete genome.
Length = 19982
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 239 tgattgccgagctgaa 254
||||||||||||||||
Sbjct: 4308 tgattgccgagctgaa 4293
>AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section 5 of
220 of the complete genome.
Length = 22892
Score = 32.2 bits (16), Expect = 1.4
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 583 atcgacagcattgtttctgc 602
|||||||| |||||||||||
Sbjct: 17980 atcgacagtattgtttctgc 17961
>embl|AE006188|AE006188 Pasteurella multocida subsp. multocida str.
Pm70 section 155 of 204 of the complete genome.
Length = 11236
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 135 aaatccgattccggt 149
|||||||||||||||
Sbjct: 3425 aaatccgattccggt 3439
>embl|AE006187|AE006187 Pasteurella multocida subsp. multocida str.
Pm70 section 154 of 204 of the complete genome.
Length = 11656
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 199 actccgcgtcagcag 213
|||||||||||||||
Sbjct: 8852 actccgcgtcagcag 8838
>embl|AE006075|AE006075 Pasteurella multocida subsp. multocida str.
Pm70 section 42 of 204 of the complete genome.
Length = 12233
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 56 atcagttgtcgattatttt 74
||||||||||| |||||||
Sbjct: 7047 atcagttgtcggttatttt 7029
>embl|AE006061|AE006061 Pasteurella multocida subsp. multocida str.
Pm70 section 28 of 204 of the complete genome.
Length = 12997
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 491 tcggcattaccgatg 505
|||||||||||||||
Sbjct: 5535 tcggcattaccgatg 5521
>AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 389 of 460 of the complete
genome.
Length = 10029
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 156 tggcgaactggttgg 170
|||||||||||||||
Sbjct: 4083 tggcgaactggttgg 4097
>AE012429 AE008922 |AE012429| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 337 of 460 of the complete
genome.
Length = 13061
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 410 ttattaccagccgcg 424
|||||||||||||||
Sbjct: 2142 ttattaccagccgcg 2156
>AE012406 AE008922 |AE012406| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 314 of 460 of the complete
genome.
Length = 13368
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 186 cgatgcgccgctgactccg 204
|||||||||||||| ||||
Sbjct: 6756 cgatgcgccgctgattccg 6738
>AE012398 AE008922 |AE012398| Xanthomonas campestris pv. campestris str.
ATCC 33913, section 306 of 460 of the complete genome.
Length = 12732
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 159 cgaactggttggcgc 173
|||||||||||||||
Sbjct: 12370 cgaactggttggcgc 12356
>AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 213 of 460 of the complete
genome.
Length = 12172
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 331 ctggttgcccgcgca 345
|||||||||||||||
Sbjct: 5321 ctggttgcccgcgca 5335
>AE012280 AE008922 |AE012280| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 188 of 460 of the complete
genome.
Length = 10801
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 148 gtactggatggcgaa 162
|||||||||||||||
Sbjct: 2561 gtactggatggcgaa 2547
>AE012254 AE008922 |AE012254| Xanthomonas campestris pv. campestris str.
ATCC 33913, section 162 of 460 of the complete genome.
Length = 11586
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 146 cggtactggatggcg 160
|||||||||||||||
Sbjct: 11009 cggtactggatggcg 11023
>AE012243 AE008922 |AE012243| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 151 of 460 of the complete
genome.
Length = 11773
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 194 cgctgactccgcgtcagca 212
||||||||||||| |||||
Sbjct: 134 cgctgactccgcggcagca 116
>AE012189 AE008922 |AE012189| Xanthomonas campestris pv. campestris str.
ATCC 33913, section 97 of 460 of the complete genome.
Length = 11333
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 24 atccagcatcctggc 38
|||||||||||||||
Sbjct: 10615 atccagcatcctggc 10629
>AE012162 AE008922 |AE012162| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 70 of 460 of the complete
genome.
Length = 11262
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 243 tgccgagctgaaagc 257
|||||||||||||||
Sbjct: 5098 tgccgagctgaaagc 5112
>AE012098 AE008922 |AE012098| Xanthomonas campestris pv. campestris
str. ATCC 33913, section 6 of 460 of the complete
genome.
Length = 10256
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 203 cgcgtcagcaggaag 217
|||||||||||||||
Sbjct: 3340 cgcgtcagcaggaag 3354
>AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section 204 of
220 of the complete genome.
Length = 21498
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 477 gttcctcggctttat 491
|||||||||||||||
Sbjct: 10726 gttcctcggctttat 10712
>AE008856 AE006468 |AE008856| Salmonella typhimurium LT2, section 160 of
220 of the complete genome.
Length = 20382
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 164 tggttggcgctctgc 178
|||||||||||||||
Sbjct: 15159 tggttggcgctctgc 15173
>AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section 133
of 220 of the complete genome.
Length = 20371
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 155 atggcgaactggttg 169
|||||||||||||||
Sbjct: 5385 atggcgaactggttg 5371
>AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section 114
of 220 of the complete genome.
Length = 23636
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 392 cgggtaaaaaagcca 406
|||||||||||||||
Sbjct: 9298 cgggtaaaaaagcca 9312
>AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section 111
of 220 of the complete genome.
Length = 20167
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 203 cgcgtcagcaggaag 217
|||||||||||||||
Sbjct: 6949 cgcgtcagcaggaag 6963
>AE008741 AE006468 |AE008741| Salmonella typhimurium LT2, section 47 of
220 of the complete genome.
Length = 25409
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 549 ggcagcgaaagcacagtct 567
||||||||||||| |||||
Sbjct: 24068 ggcagcgaaagcagagtct 24086
>AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section 35
of 220 of the complete genome.
Length = 22671
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 495 cattaccgatgtgaa 509
|||||||||||||||
Sbjct: 8666 cattaccgatgtgaa 8652
Database: 3g
Posted date: Oct 3, 2007 6:35 PM
Number of letters in database: 12,243,887
Number of sequences in database: 884
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 884
Number of Hits to DB: 86,913
Number of extensions: 5119
Number of successful extensions: 36
Number of sequences better than 10.0: 32
Number of HSP's gapped: 34
Number of HSP's successfully gapped: 34
Length of query: 606
Length of database: 12,243,887
Length adjustment: 17
Effective length of query: 589
Effective length of database: 12,228,859
Effective search space: 7202797951
Effective search space used: 7202797951
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
S2: 15 (30.2 bits)
|