Документ взят из кэша поисковой машины. Адрес оригинального документа : http://kodomo.cmm.msu.ru/~solveig/Practice1/b3.html
Дата изменения: Wed Oct 10 06:52:41 2007
Дата индексирования: Tue Oct 2 08:55:53 2012
Кодировка: Windows-1251
Azor_Ecoli.entered   [Назад]



BLASTN 2.2.15 [Oct-15-2006]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= D85081 D85081.1 Escherichia coli gene, replication terminus
region, partial and complete cds.
         (606 letters)

Database: 3g 
           884 sequences; 12,243,887 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section...   293   2e-79
AE012230 AE008922 |AE012230| Xanthomonas campestris pv. campestr...    34   0.37 
AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestr...    34   0.37 
AE008759 AE006468 |AE008759| Salmonella typhimurium LT2, section...    34   0.37 
AE008695 AE006468 |AE008695| Salmonella typhimurium LT2, section...    34   0.37 
AE012370 AE008922 |AE012370| Xanthomonas campestris pv. campestr...    32   1.4  
AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestr...    32   1.4  
AE008833 AE006468 |AE008833| Salmonella typhimurium LT2, section...    32   1.4  
AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section...    32   1.4  
AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section...    32   1.4  
embl|AE006188|AE006188 Pasteurella multocida subsp. multocida st...    30   5.7  
embl|AE006187|AE006187 Pasteurella multocida subsp. multocida st...    30   5.7  
embl|AE006075|AE006075 Pasteurella multocida subsp. multocida st...    30   5.7  
embl|AE006061|AE006061 Pasteurella multocida subsp. multocida st...    30   5.7  
AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestr...    30   5.7  
AE012429 AE008922 |AE012429| Xanthomonas campestris pv. campestr...    30   5.7  
AE012406 AE008922 |AE012406| Xanthomonas campestris pv. campestr...    30   5.7  
AE012398 AE008922 |AE012398| Xanthomonas campestris pv. campestr...    30   5.7  
AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestr...    30   5.7  
AE012280 AE008922 |AE012280| Xanthomonas campestris pv. campestr...    30   5.7  
AE012254 AE008922 |AE012254| Xanthomonas campestris pv. campestr...    30   5.7  
AE012243 AE008922 |AE012243| Xanthomonas campestris pv. campestr...    30   5.7  
AE012189 AE008922 |AE012189| Xanthomonas campestris pv. campestr...    30   5.7  
AE012162 AE008922 |AE012162| Xanthomonas campestris pv. campestr...    30   5.7  
AE012098 AE008922 |AE012098| Xanthomonas campestris pv. campestr...    30   5.7  
AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section...    30   5.7  
AE008856 AE006468 |AE008856| Salmonella typhimurium LT2, section...    30   5.7  
AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section...    30   5.7  
AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section...    30   5.7  
AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section...    30   5.7  
AE008741 AE006468 |AE008741| Salmonella typhimurium LT2, section...    30   5.7  
AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section...    30   5.7  

>AE008772 AE006468 |AE008772| Salmonella typhimurium LT2, section 76 of
             220 of the complete genome.
          Length = 20609

 Score =  293 bits (148), Expect = 2e-79
 Identities = 339/400 (84%), Gaps = 2/400 (0%)
 Strand = Plus / Plus

                                                                         
Query: 1     atgagcaaggtattagttcttaaatccagcatcctggcagggtactctcagtctaatcag 60
             ||||||||||||||||||||||||||||| || |||||||||||||||||||||  ||||
Sbjct: 16106 atgagcaaggtattagttcttaaatccagtattctggcagggtactctcagtctggtcag 16165

                                                                         
Query: 61    ttgtc-gattattttgttgaacaatggcgcgaaaagcactccgcgtgatgaaatcaccgt 119
             ||| | || |||||| ||||||||||||||||||| |||  |||  |||||||| || ||
Sbjct: 16166 ttgactgactattttattgaacaatggcgcgaaaaacacgtcgca-gatgaaattactgt 16224

                                                                         
Query: 120   tcgcgacctggctgcaaatccgattccggtactggatggcgaactggttggcgctctgcg 179
              ||||| ||||| || || ||  ||||||| ||||||||||| ||||| |||||  ||||
Sbjct: 16225 ccgcgatctggcggccaaccctgttccggtgctggatggcgagctggtgggcgcgatgcg 16284

                                                                         
Query: 180   tccgagcgatgcgccgctgactccgcgtcagcaggaagctctggcactttccgatgagtt 239
             |||| ||||||||||  | || || ||||||||||| |||||||| || || |||||  |
Sbjct: 16285 tccgggcgatgcgcctttaacgccacgtcagcaggacgctctggcgctgtctgatgaact 16344

                                                                         
Query: 240   gattgccgagctgaaagcccacgacgttatcgttattgcggcaccgatgtataacttcaa 299
              ||||| || ||||||||||||||||| |||||||||||||| |||||||| || |||||
Sbjct: 16345 cattgctgaactgaaagcccacgacgtcatcgttattgcggcgccgatgtacaatttcaa 16404

                                                                         
Query: 300   catctcgactcagttgaaaaactattttgacctggttgcccgcgcaggcgttactttccg 359
              ||| |||| ||| |||||||||| ||||| ||| |||||||||| ||  | ||||||||
Sbjct: 16405 tatcccgacgcagctgaaaaactactttgatctgattgcccgcgccggtatcactttccg 16464

                                                     
Query: 360   ctataccgagaacggtccggaaggtctggtaacgggtaaa 399
             ||||||||| || || ||||||||||||||||| ||||||
Sbjct: 16465 ctataccgaaaaaggcccggaaggtctggtaaccggtaaa 16504



 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                            
Query: 569  acgcaaaagcagccat 584
            ||||||||||||||||
Sbjct: 3410 acgcaaaagcagccat 3395


>AE012230 AE008922 |AE012230| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 138 of 460 of the complete
            genome.
          Length = 10813

 Score = 34.2 bits (17), Expect = 0.37
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 415  accagccgcggcgggat 431
            |||||||||||||||||
Sbjct: 6668 accagccgcggcgggat 6652


>AE012104 AE008922 |AE012104| Xanthomonas campestris pv. campestris str.
             ATCC 33913,  section 12 of 460 of the complete genome.
          Length = 12966

 Score = 34.2 bits (17), Expect = 0.37
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 151   ctggatggcgaactggt 167
             |||||||||||||||||
Sbjct: 10214 ctggatggcgaactggt 10230


>AE008759 AE006468 |AE008759| Salmonella typhimurium LT2, section 63
            of 220 of the complete genome.
          Length = 20279

 Score = 34.2 bits (17), Expect = 0.37
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 495  cattaccgatgtgaaat 511
            |||||||||||||||||
Sbjct: 8449 cattaccgatgtgaaat 8433


>AE008695 AE006468 |AE008695| Salmonella typhimurium LT2, section 3 of
            220 of the complete genome.
          Length = 23563

 Score = 34.2 bits (17), Expect = 0.37
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 239  tgattgccgagctgaaa 255
            |||||||||||||||||
Sbjct: 9554 tgattgccgagctgaaa 9538


>AE012370 AE008922 |AE012370| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 278 of 460 of the complete
            genome.
          Length = 13098

 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                            
Query: 416  ccagccgcggcgggat 431
            ||||||||||||||||
Sbjct: 3823 ccagccgcggcgggat 3838


>AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 13 of 460 of the complete
            genome.
          Length = 11990

 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                            
Query: 179  gtccgagcgatgcgcc 194
            ||||||||||||||||
Sbjct: 7797 gtccgagcgatgcgcc 7812


>AE008833 AE006468 |AE008833| Salmonella typhimurium LT2, section 137 of
             220 of the complete genome.
          Length = 20984

 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                             
Query: 367   gagaacggtccggaag 382
             ||||||||||||||||
Sbjct: 11256 gagaacggtccggaag 11241


>AE008815 AE006468 |AE008815| Salmonella typhimurium LT2, section 119
            of 220 of the complete genome.
          Length = 19982

 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                            
Query: 239  tgattgccgagctgaa 254
            ||||||||||||||||
Sbjct: 4308 tgattgccgagctgaa 4293


>AE008697 AE006468 |AE008697| Salmonella typhimurium LT2, section 5 of
             220 of the complete genome.
          Length = 22892

 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                 
Query: 583   atcgacagcattgtttctgc 602
             |||||||| |||||||||||
Sbjct: 17980 atcgacagtattgtttctgc 17961


>embl|AE006188|AE006188 Pasteurella multocida subsp. multocida str.
            Pm70 section 155 of 204 of the complete genome.
          Length = 11236

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 135  aaatccgattccggt 149
            |||||||||||||||
Sbjct: 3425 aaatccgattccggt 3439


>embl|AE006187|AE006187 Pasteurella multocida subsp. multocida str.
            Pm70 section 154 of 204 of the complete genome.
          Length = 11656

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 199  actccgcgtcagcag 213
            |||||||||||||||
Sbjct: 8852 actccgcgtcagcag 8838


>embl|AE006075|AE006075 Pasteurella multocida subsp. multocida str.
            Pm70 section 42 of 204 of the complete genome.
          Length = 12233

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                               
Query: 56   atcagttgtcgattatttt 74
            ||||||||||| |||||||
Sbjct: 7047 atcagttgtcggttatttt 7029


>embl|AE006061|AE006061 Pasteurella multocida subsp. multocida str.
            Pm70 section 28 of 204 of the complete genome.
          Length = 12997

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 491  tcggcattaccgatg 505
            |||||||||||||||
Sbjct: 5535 tcggcattaccgatg 5521


>AE012481 AE008922 |AE012481| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 389 of 460 of the complete
            genome.
          Length = 10029

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 156  tggcgaactggttgg 170
            |||||||||||||||
Sbjct: 4083 tggcgaactggttgg 4097


>AE012429 AE008922 |AE012429| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 337 of 460 of the complete
            genome.
          Length = 13061

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 410  ttattaccagccgcg 424
            |||||||||||||||
Sbjct: 2142 ttattaccagccgcg 2156


>AE012406 AE008922 |AE012406| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 314 of 460 of the complete
            genome.
          Length = 13368

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                               
Query: 186  cgatgcgccgctgactccg 204
            |||||||||||||| ||||
Sbjct: 6756 cgatgcgccgctgattccg 6738


>AE012398 AE008922 |AE012398| Xanthomonas campestris pv. campestris str.
             ATCC 33913,  section 306 of 460 of the complete genome.
          Length = 12732

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                            
Query: 159   cgaactggttggcgc 173
             |||||||||||||||
Sbjct: 12370 cgaactggttggcgc 12356


>AE012305 AE008922 |AE012305| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 213 of 460 of the complete
            genome.
          Length = 12172

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 331  ctggttgcccgcgca 345
            |||||||||||||||
Sbjct: 5321 ctggttgcccgcgca 5335


>AE012280 AE008922 |AE012280| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 188 of 460 of the complete
            genome.
          Length = 10801

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 148  gtactggatggcgaa 162
            |||||||||||||||
Sbjct: 2561 gtactggatggcgaa 2547


>AE012254 AE008922 |AE012254| Xanthomonas campestris pv. campestris str.
             ATCC 33913,  section 162 of 460 of the complete genome.
          Length = 11586

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 146   cggtactggatggcg 160
             |||||||||||||||
Sbjct: 11009 cggtactggatggcg 11023


>AE012243 AE008922 |AE012243| Xanthomonas campestris pv. campestris
           str. ATCC 33913,  section 151 of 460 of the complete
           genome.
          Length = 11773

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                              
Query: 194 cgctgactccgcgtcagca 212
           ||||||||||||| |||||
Sbjct: 134 cgctgactccgcggcagca 116


>AE012189 AE008922 |AE012189| Xanthomonas campestris pv. campestris str.
             ATCC 33913,  section 97 of 460 of the complete genome.
          Length = 11333

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 24    atccagcatcctggc 38
             |||||||||||||||
Sbjct: 10615 atccagcatcctggc 10629


>AE012162 AE008922 |AE012162| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 70 of 460 of the complete
            genome.
          Length = 11262

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 243  tgccgagctgaaagc 257
            |||||||||||||||
Sbjct: 5098 tgccgagctgaaagc 5112


>AE012098 AE008922 |AE012098| Xanthomonas campestris pv. campestris
            str. ATCC 33913,  section 6 of 460 of the complete
            genome.
          Length = 10256

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 203  cgcgtcagcaggaag 217
            |||||||||||||||
Sbjct: 3340 cgcgtcagcaggaag 3354


>AE008900 AE006468 |AE008900| Salmonella typhimurium LT2, section 204 of
             220 of the complete genome.
          Length = 21498

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                            
Query: 477   gttcctcggctttat 491
             |||||||||||||||
Sbjct: 10726 gttcctcggctttat 10712


>AE008856 AE006468 |AE008856| Salmonella typhimurium LT2, section 160 of
             220 of the complete genome.
          Length = 20382

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 164   tggttggcgctctgc 178
             |||||||||||||||
Sbjct: 15159 tggttggcgctctgc 15173


>AE008829 AE006468 |AE008829| Salmonella typhimurium LT2, section 133
            of 220 of the complete genome.
          Length = 20371

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 155  atggcgaactggttg 169
            |||||||||||||||
Sbjct: 5385 atggcgaactggttg 5371


>AE008810 AE006468 |AE008810| Salmonella typhimurium LT2, section 114
            of 220 of the complete genome.
          Length = 23636

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 392  cgggtaaaaaagcca 406
            |||||||||||||||
Sbjct: 9298 cgggtaaaaaagcca 9312


>AE008807 AE006468 |AE008807| Salmonella typhimurium LT2, section 111
            of 220 of the complete genome.
          Length = 20167

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 203  cgcgtcagcaggaag 217
            |||||||||||||||
Sbjct: 6949 cgcgtcagcaggaag 6963


>AE008741 AE006468 |AE008741| Salmonella typhimurium LT2, section 47 of
             220 of the complete genome.
          Length = 25409

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                
Query: 549   ggcagcgaaagcacagtct 567
             ||||||||||||| |||||
Sbjct: 24068 ggcagcgaaagcagagtct 24086


>AE008727 AE006468 |AE008727| Salmonella typhimurium LT2, section 35
            of 220 of the complete genome.
          Length = 22671

 Score = 30.2 bits (15), Expect = 5.7
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                           
Query: 495  cattaccgatgtgaa 509
            |||||||||||||||
Sbjct: 8666 cattaccgatgtgaa 8652


  Database: 3g
    Posted date:  Oct 3, 2007  6:35 PM
  Number of letters in database: 12,243,887
  Number of sequences in database:  884
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 884
Number of Hits to DB: 86,913
Number of extensions: 5119
Number of successful extensions: 36
Number of sequences better than 10.0: 32
Number of HSP's gapped: 34
Number of HSP's successfully gapped: 34
Length of query: 606
Length of database: 12,243,887
Length adjustment: 17
Effective length of query: 589
Effective length of database: 12,228,859
Effective search space: 7202797951
Effective search space used: 7202797951
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
S2: 15 (30.2 bits)




 

Спивак Ольга