Äîêóìåíò âçÿò èç êýøà ïîèñêîâîé ìàøèíû. Àäðåñ îðèãèíàëüíîãî äîêóìåíòà : http://www.genebee.msu.ru/LPSR/Zolotukhin_MCB2003.pdf Äàòà èçìåíåíèÿ: Sun Nov 30 18:25:28 2008 Äàòà èíäåêñèðîâàíèÿ: Tue Oct 2 01:30:05 2012 Êîäèðîâêà:

MOLECULAR AND CELLULAR BIOLOGY, Sept. 2003, p. 6618­6630 0270-7306/03/$08.00 0 DOI: 10.1128/MCB.23.18.6618­6630.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Vol. 23, No. 18

PSF Acts through the Human Immunodeficiency Virus Type 1 mRNA Instability Elements To Regulate Virus Expression
Andrei S. Zolotukhin,1 Daniel Michalowski,1 Jenifer Bear,1 Sergey V. Smulevitch,1 Abdulmaged M. Traish,2 Rui Peng,3 James Patton,3 Ivan N. Shatsky,4 and Barbara K. Felber1*
Human Retrovirus Pathogenesis Section, Basic Research Laboratory, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702-12011; Department of Biochemistry, School of Medicine, Boston University, Boston, Massachusetts 021182; Department of Molecular Biology, Vanderbilt University, Nashville, Tennessee 37235-18203; and A. N. Belozersky Institute, Moscow State University, Moscow, Russia4
Received 7 May 2003/Returned for modification 30 May 2003/Accepted 11 June 2003

Human immunodeficiency virus type 1 (HIV) gag/pol and env mRNAs contain cis-acting regulatory elements (INS) that impair stability, nucleocytoplasmic transport, and translation by unknown mechanisms. This downregulation can be counteracted by the viral Rev protein, resulting in efficient export and expression of these mRNAs. Here, we show that the INS region in HIV-1 gag mRNA is a high-affinity ligand of p54nrb/PSF, a heterodimeric transcription/splicing factor. Both subunits bound INS RNA in vitro with similar affinity and specificity. Using an INS-containing subgenomic gag mRNA, we show that it specifically associated with p54nrb in vivo and that PSF inhibited its expression, acting via INS. Studying the authentic HIV-1 mRNAs produced from an infectious molecular clone, we found that PSF affected specifically the INS-containing, Rev-dependent transcripts encoding Gag-Pol and Env. Both subunits contained nuclear export and nuclear retention signals, whereas p54nrb was continuously exported from the nucleus and associated with INS-containing mRNA in the cytoplasm, suggesting its additional role at late steps of mRNA metabolism. Thus, p54nrb and PSF have properties of key factors mediating INS function and likely define a novel mRNA regulatory pathway that is hijacked by HIV-1.

Many eukaryotic mRNAs are subject to regulated turnover via cis-acting signals which are recognized by trans-acting factors. The best-studied example is the cytoplasmic mRNA decay mediated by cis-acting AU-rich RNA elements and trans-acting ARE-binding proteins. Another important mechanism is nonsense-mediated mRNA decay, which serves to eliminate the transcripts that contain premature stop codons (for recent reviews, see references 17, 34, and 40). In contrast to cytoplasmic pathways, nuclear mRNA turnover is less well understood. Among the mRNAs that are subject to nuclear downregulation are the Rev-responsive element (RRE)-containing mRNAs of human immunodeficiency virus type 1 (HIV-1) (11, 22, 25, 26, 32, 33, 42, 48, 54; reviewed in references 13, 21, 27, and 47). These unspliced and nonterminally spliced transcripts need to be exported from the nucleus before completion of splicing to produce the Gag-Pol and Env proteins. This regulatory step is accomplished by the viral Rev protein, which binds to the RRE and links these transcripts to the CRM1 export receptor. In the absence of Rev, these mRNAs are further spliced to completion or degraded. However, even when devoid of splice sites, the unspliced or nonterminally spliced mRNAs are poorly expressed due to the presence of cis-acting instability elements (INS/ CRS) that are scattered throughout the gag/pol and env mRNAs (11, 25, 32, 42, 50, 51, 54). These elements act at several steps, impairing mRNA stability, nucleocytoplasmic
* Corresponding author. Mailing address: NCI-Frederick, Bldg. 535, Rm. 110, Frederick, MD 21702-1201. Phone: (301) 846-5159. Fax: (301) 846-7146. E-mail: felber@mail.ncifcrf.gov. 6618

transport, and translation (5, 15, 22, 29, 33, 51, 54), whereas Rev counteracts these defects, resulting in efficient expression. However, Rev is unable to export nonterminally spliced mRNAs that do not contain a functional INS (51), and hence, INS are an integral part of Rev regulation. Functionally analogous elements are found in all lentiviruses and viruses of the human T-cell lymphotropic virus family, indicating their biological relevance. Several mRNA-binding proteins, including PTB/hnRNP I, hnRNP A1, and PABP1, were shown to bind specifically to such elements in vitro (2, 3, 9, 10, 41). It is thought that the INS-binding factors may divert these mRNAs from the splicing route and promote their association with Rev, enabling their export and expression. Because these factors are abundant, ubiquitous components of general mRNPs, the functional relevance of such interactions was difficult to address. Here, we further investigated the mechanism of INS-mediated mRNA regulation, using the best-characterized INS within the 5 portion of HIV-1 gag (p37gag). This INS spans more than 1 kb and can be inactivated by silent point mutations in eight regions, resulting in a mutant gene termed INS( )M1-10 (50, 51, 54) (Fig. 1). Although AU-rich, these regions are functionally and structurally unrelated to AU-rich RNA elements (37, 50, 51, 54) and do not show homology to other known cellular mRNA instability elements. In this study, we found that INS assembles specifically with nuclear factors PSF and p54nrb in nuclear extracts. Human p54nrb and PSF are nucleic acid-binding proteins that form a heterodimer (45, 61), and p54nrb is 71% identical to the Cterminal portion of PSF (16, 24, 44, 61). PSF participates in


VOL. 23, 2003

DOWNREGULATION OF HIV-1 EXPRESSION BY PSF

6619

HIV molecular clone, resulting in loss of gag-pol and env expression and hence no virus production. Therefore, PSF is one of the key factors mediating the posttranscriptional regulation of HIV-1. Thus, this study provides insight into a new control of HIV-1 replication and suggests that PSF is likely part of a novel mRNA regulatory mechanism.
MATERIALS AND METHODS Transcription in vitro. As DNA templates for in vitro transcription, PCR fragments that were produced with sense primers that contained T7 promoter sequences were used. For polyadenylated transcripts, the antisense primers also included a 98-nucleotide oligo(dT) sequence. The capped, polyadenylated RNAs were produced with Message Machine kits (Ambion). For uncapped transcripts, Megascript kits (Ambion) were used. For biotinylated RNAs, transcription mixes were supplemented with biotin-16-UTP (Roche), at 1/100 of the total UTP concentration. Radioactively labeled transcripts were produced by standard protocols with an equimolar mix of [32P] ATP and [32P] GTP. Protein-RNA assembly in nuclear extracts. Nuclear extracts were prepared (30) from HeLa cells which were grown and fractionated as described previously (7). The extracts were used without nuclease pretreatment to ensure strong competitive binding conditions. Prior to use, the extracts were adjusted to 200 mM NaCl, 0.1% Triton X-100, and 2 mg of tRNA per ml and cleared with empty streptavidin-containing magnetic beads (M-280; Dynal). The biotin-labeled capped, polyadenylated p37gag RNAs were immobilized on M-280 beads according to the manufacturers' protocol and incubated with cleared extracts for 1 h at 30°C. The assembled proteins were eluted by micrococcal nuclease digestion, separated on sodium dodecyl sulfate­10% polyacrylamide gel electrophoresis (SDS-PAGE), and stained with Coomassie. RNA binding and UV cross-linking in vitro. Binding reactions contained p54nrb and PSF proteins at 1 M and 32P-labeled RNA probes at 1 M (oligoribonucleotides) or 20 nM (full-length p37gag and luc RNAs). Binding was performed in 15 mM HEPES (pH 7.7)­50 mM KCl­200 mM NaCl­0.2 mM EDTA­0.5% Triton X-100 for 15 min at room temperature, followed by UVirradiation in a Stratalinker (15 min at time mode 4C). When using uniformly labeled RNAs, the reactions were treated with 1 mg of RNase A per ml for 15 min at 37°C after irradiation. The products were separated on SDS­10% PAGE and quantified with a phosphorimager. For competition experiments, the 50% inhibitory concentrations (IC50) were calculated with linear interpolation. Synthetic oligoribonucleotide probes that were used to map the interaction sites within p37gag INS were 32 nucleotides in length and spanned the previously published INS subregions (50, 51). Such probes represented the wild-type or INS( ) HIV-1 gag sequences. As an additional control, the wild-type sequences were randomized while preserving the nucleotide content. Recombinant DNA. The eukaryotic expression plasmids for INS( )-RRE and INS( )M1-10 (50), green fluorescent protein (GFP)-PSF (18), GFP-p54nrb (45), the Escherichia coli expression plasmids for p54nrb (16) and PSF (44), and the codon-optimized HIV-1 gag gene (28) have been described. The eukaryotic expression plasmid for p54nrb-GFP was constructed by PCR amplification of p54nrb-cDNA (16) and cloning in-frame with the GFP coding sequence (cds) into the NheI site of the pF25 vector (58). The HIV-1 proviral plasmid pNL4-3 (1), rev expression plasmid pBsrev (14), env cDNA expression plasmids pNL1.5E (53) and pNL1.5E SS (42), and nef cDNA expression plasmid pNL1.5.7 (52) were described. The 1.5E INS( ) plasmid was constructed by replacing the env cds of pNL1.5E SS (EcoRI-XhoI) with the mutant INS( ) env cds (EcoRIXhoI) derived from HIV-1 isolate 6101, which also lacks the splice sites (Rosati et al., unpublished data). Cell culture, transfections, shuttling assay, and cell fractionation. Transfections in human 293 or HeLa-derived HLtat cells, HIV-1 p24gag, luciferase, and GFP measurements were performed (65). Nucleocytoplasmic shuttling assays were performed as described previously (6). Preparation of subcellular extracts of 293 cells was described previously (64). Recombinant proteins. Recombinant p54nrb and His6-tagged PSF were produced in E. coli as soluble proteins and isolated on Ni-nitrilotriacetic acidagarose following standard protocols. For RNA-binding studies, the proteins were further purified by affinity chromatography on a biotinylated ribonucleotide (ACAAGAUUUAAACACCAUGCUAAACACAGUG) that was immobilized on streptavidin-coated Dynabeads. The proteins were bound at 80 mM NaCl in 20 mM phosphate buffer, pH 7.4, and eluted stepwise with 80 to 400 mM NaCl. The fractions that were retained at 250 mM were pooled and stored at 20°C.

FIG. 1. Assembly of nuclear proteins onto INS-RNA. The in vitrotranscribed INS( ) and INS( ) RNAs are shown schematically, indicating the 5 untranslated region (UTR), p37gag cds, RRE, and poly(A) site and the deletion destroying the major HIV-1 5 splice site [SD( )]. In INS( ) RNA, the regions containing inactivating mutations (50) are shown by X. The INS( ) and INS( ) RNAs were immobilized on streptavidin beads and incubated with HeLa nuclear extracts. The assembled proteins were separated by SDS-PAGE and stained with Coomassie, and the major bands in the INS( )-bound fraction were identified by microsequencing, as shown to the right. The sizes of marker proteins are shown (in kilodaltons).

both early and late steps of splicing (reference 45 and references therein), and p54nrb is also involved in splicing (16). PSF associates with polypyrimidine tract-binding protein (44) and with the small nuclear ribonucleoprotein (snRNP)-free form of U1A protein (31), whereas both p54nrb and PSF bind specifically to U5 snRNA in vitro (45), but their exact role in splicing remains unclear. Mammalian PSF and p54nrb have also been implicated in transcriptional regulation (reviewed in reference 56). Apparently, p54nrb/PSF has the potential to bind pre-mRNA cotranscriptionally, because both subunits bind avidly to the carboxy-terminal domain of the largest subunit of RNA polymerase II (19). Both p54nrb and PSF were found in the nuclear subdomains known as splicing speckles (18), and p54nrb also localizes to paraspeckles, a distinct nuclear domain that additionally contains a p54nrb-related PSP1 protein (23). PSF, p54nrb, PSP1 as well as PSP2/CoAA, another paraspecklespecific protein, were shown to associate with the nucleolus upon inhibition of transcription (4), indicating that they are dynamically localized. The Chironomus tentans p54nrb-related protein hrp65 has been found in filaments attached to some nuclear mRNPs, suggesting a role in mRNA trafficking (39). Hence, p54nrb and PSF are multifunctional factors that are involved in a variety of nuclear processes (for a recent review, see reference 56). In addition, p54nrb was recently shown to bind specifically to hyperedited, inosine-containing RNAs (I-RNA), leading to their nuclear retention. The I-RNA-binding complex also includes PSF and a nuclear matrix protein, matrin 3 (62). These data predicted that p54nrb/PSF could act similarly on other high-affinity RNA ligands, such as INS-containing mRNAs (INS-mRNA). Here, we show that p54nrb and PSF have properties of trans-acting factors that bind directly to the INS located in p37gag of HIV-1. We further found that PSF specifically downregulates INS-containing mRNA produced by an


6620

ZOLOTUKHIN ET AL.

MOL. C

ELL.

B

IOL

.

Antibodies, immunoblots, Northern blots, and immunoprecipitation. Rabbit anti-p54nrb serum was described previously (60). HIV-1 patient serum (Scripps) and monoclonal antibodies to p54nrb (Transduction Labs) were used according to the manufacturers' instructions. The B92 monoclonal antibodies (55) were obtained from D. Zipori or purchased from Sigma. The HIV-1 rabbit anti-gp120 antiserum was a gift from L. Arthur. Northern blot analyses of HIV-1 mRNAs were performed (25) with a probe that is complementary to all HIV-1 transcripts, and the luciferase mRNA was detected with a full-length cds probe. Western blots of HIV-1 proteins (25) and analyses of mRNP complexes (46, 64) were performed as described previously.

RESULTS Identification of proteins that assemble with p37gag mRNA in vitro. To identify the proteins that recognize the INS in p37gag mRNA, we assembled the complexes from nuclear HeLa extracts onto in vitro-transcribed, immobilized RNA. To ensure that the INS is recognized in its authentic context, we used a full-length transcript that was 7mGpppG-capped, contained the HIV-1 5 untranslated region, wild-type p37gag cds, the RRE element, and a 98-nucleotide poly(A) tail [Fig. 1, INS( )]. As control, the matching INS( )M1-10 RNA was used [Fig. 1, INS(-)]. To reduce the assembly of spliceosomal components, both RNAs had a deletion destroying the major HIV-1 5 splice site [Fig. 1, SD( )]. The bound proteins were eluted by micrococcal nuclease digestion to exclude the RNAindependent binders and separated on SDS-PAGE. Figure 1 shows that several proteins associated preferentially with the INS( ) RNA. The major bands were microsequenced, and all of them produced high-confidence matches to known human proteins. Three groups of proteins were identified: (i) PSF and p54nrb; (ii) polyadenylate-binding protein PABP1 or/and its homologs (the peptides did not discriminate between several closely related proteins); and (iii) heterogenous nuclear RNP (hnRNP) A/B family proteins. The identification of PABP1 and hnRNP A1 is in agreement with previous findings (2, 3, 9, 10, 41) and confirms the validity of our assembly conditions. We focused on the novel INS binders p54nrb and PSF. p54nrb/PSF is sufficient for INS recognition in vitro. Since p54nrb and PSF form a heterodimer (45, 61), it is possible that one or both subunits bound to INS directly (Fig. 1). Alternatively, additional factors could have facilitated the binding. We therefore asked whether p54nrb/PSF could recognize the INS directly in the absence of nuclear extract. For in vitro RNA binding studies, we used the p54nrb/PSF dimer that was purified from human cells (59) (Fig. 2A, h-p54nrb/PSF). The INS( ) RNA contained the wild-type p37gag coding sequence, whereas in the matching INS( ) RNA, the INS was destroyed by codon swapping (28), and both RNAs lacked the cap structure, the 5 untranslated region, the RRE element, and the poly(A) site. As an additional nonspecific control, we used an RNA comprising the complete luciferase (luc) cds, which is of similar size. The probes were double labeled at A and G residues to reduce the composition biases, adjusted to the same specific radioactivity, and used at equimolar amounts. All RNAs ran as single bands of the expected size on denaturing PAGE (not shown). Since these RNAs were more than 1 kb in size, we used UV cross-linking to analyze protein binding. We found that both subunits cross-linked efficiently to INS( ) and, to a much lesser extent, to the luc probe (Fig. 2B), indicating preferential binding. Accordingly, luc RNA did not

compete with the INS( ) probe, even at the highest concentration tested (135 nM), while it competed efficiently with itself (Fig. 2C). Conversely, the INS( ) RNA competed with the luc probe under the same conditions (not shown). Hence, PSF and p54nrb bound to INS( ) RNA in a structure-specific manner. To verify that the INS is responsible for specific binding, we compared the ability of INS( ) and INS( ) RNAs to compete for p54nrb/PSF. To assess the competitor efficiencies, their 50% inhibitory concentrations (IC50) were determined by quantification of cross-linked bands. We note that, due to the nature of this assay, such values may represent a semiquantitative estimate. With the INS( ) probe (Fig. 2D and 2F), the INS( ) RNA competed strongly (IC50 40 nM), whereas the INS( ) RNA did not compete even at the highest concentration tested (IC50 270 nM). Thus, the INS inactivation reduced the binding of p54nrb and PSF by at least sixfold. Under these conditions, both subunits bound to INS with apparent dissociation constants of 40 nM. Despite similar constants, the cross-linking efficiencies were reproducibly higher for PSF, suggesting that it makes tighter contacts with RNA. Using luc as the probe also revealed differences between the competitor RNAs INS( ) (IC50 30 nM) and INS( ) (IC50 100 nM) for both subunits (results not shown). Thus, p54nrb and PSF recognized the INS in the absence of nuclear extracts. Since the human p54nrb/PSF fraction contained only minor contaminants (Fig. 2A) that did not exhibit RNA binding (not shown), p54nrb/PSF was likely sufficient for recognition. To further support this conclusion, we used E. coli-produced recombinant proteins that were purified by RNA affinity chromatography (Fig. 2A, r-p54nrb and r-PSF) and were mixed at a 1:1 molar ratio. With INS( ) RNA as the probe, we found that both r-p54nrb and r-PSF discriminated efficiently between the INS( ) and INS( ) competitors: INS( ) IC50 100 nM, and INS( )IC50, 600 nM (Fig. 2E). When used individually, both the r-p54nrb and r-PSF subunits also showed INS recognition, but they exhibited a lesser degree of discrimination between the INS( ) and INS( ) competitors (not shown). We concluded that p54nrb/PSF can recognize INS by itself. These results also indicated that the INS region is sufficient for the p54nrb/PSF binding that was observed in the initial assembly experiments (Fig. 1). To study the possible direct recognition sites within INS, we UV-cross-linked h-p54nrb/PSF to synthetic oligoribonucleotides representing the individual regions that are affected by INS-inactivating M1-10 mutations (50). For three of the eight regions tested, p54nrb and PSF cross-linked strongly to the wild-type but not to the mutant or shuffled sequences, suggesting the presence of direct recognition sites, whereas the other probes did not show evidence of sequence-specific binding (data not shown). It is therefore plausible that some of the M1-10 mutations act directly by destroying the p54nrb/PSF recognition motifs, while the others may affect recognition in an allosteric manner. p54nrb interacts specifically with INS-mRNA in vivo. To address the binding of p54nrb and PSF to INS in vivo, INS( )RRE mRNA was transiently expressed in human 293 cells. As a control, luc was coexpressed, since this mRNA was shown to bind poorly to p54nrb/PSF in vitro (see above, Fig. 2B, C). These cells were fractionated, yielding cytoplasmic, soluble nuclear, and insoluble nuclear fractions (Fig. 3) (38, 64). West-


V

OL

. 23, 2003

DOWNREGULATION OF HIV-1 EXPRESSION BY PSF

6621

FIG. 2. p54nrb and PSF bind specifically to INS-RNA in vitro. (A) SDS-PAGE analysis of purified p54nrb/PSF proteins. r-PSF, recombinant His-tagged PSF; h-p54nrb/PSF, purified human p54nrb/PSF dimer; r-p54nrb, recombinant p54nrb. The sizes of marker proteins are shown (in kilodaltons). The positions of p54nrb and PSF are indicated to the right. Asterisks indicate the bands of contaminating proteins in the h-p54nrb/PSF fraction. (B to E) RNA binding/UV cross-linking with purified human (B, C, and D) and recombinant (E) p54nrb/PSF dimer. The radioactive RNA probes (indicated on the left) and the competitor RNAs (indicated on the right) are indicated. The competitors were present at final concentrations of 15, 45, and 135 nM (C); 5, 15, 45, 135, and 270 nM (panel D); and 77, 156, 311, and 622 nM (E), as indicated by triangles. As a control, some reactions were not UV-irradiated, as indicated at the bottom. The cross-linked p54nrb and PSF proteins (indicated by arrowheads) were separated by SDS-PAGE and detected by autoradiography. In panel C, a stronger exposure was used to visualize the luc probe cross-links. (F) Quantification of the cross-links from panel D. The radioactivity values were determined with a phosphorimager, normalized to those obtained without competition (fraction of probe bound, y axis), and were plotted against the competitor concentrations (x axis).

ern blot analysis showed that p54nrb and PSF were enriched in insoluble nuclear fractions, consistent with their association with the insoluble nuclear components (35, 60). Small amounts of these proteins were also found in the cytoplasmic and soluble nuclear fractions (Fig. 3A). We noted that both subunits contained nuclear export determinants (see below, Fig. 7), and therefore, their presence in the cytoplasm is not likely an artifact. To verify the quality of fractionation, we analyzed nuclear markers such as snRNA U2 and U5 and U2AF35 protein. As expected, the bulk of U2 and U5 snRNAs and U2AF35 protein cofractionated with the insoluble nuclear fraction (Fig. 3A), which is enriched in spliceosomal components and pre-mRNA (38, 64). Low levels of these markers were also detectable in the soluble nuclear fraction. While small amounts of U5 snRNA were also found in the cytoplasmic fraction, the U2 snRNA and U2AF35 protein were excluded from this fraction, indicating that there was no general leakage of nuclear components. To probe the association of INS-mRNA with p54nrb, we performed native immunoprecipitations with monospecific antibodies (Fig. 3B). After immunoprecipitation, the INS-mRNA

was analyzed on Northern blots (Fig. 3C, p37gag probe), both in the precipitates (Fig. 3C; bound, B) and the supernatants (Fig. 3C; unbound, U). In the unbound samples, the INS-mRNA was found in all subcellular fractions (Fig. 3C). The antip54nrb (Fig. 3C) but not normal rabbit serum (not shown) precipitated INS-mRNAs efficiently from cytoplasmic and soluble nuclear fractions but to a much lesser extent from the insoluble nuclear fraction despite the enrichment of p54nrb in this fraction (Fig. 3A). Thus, the immunoprecipitation likely reflected the interactions prior to cell fractionation rather than reassociation in cell extracts. Compared to INS-mRNA on the same blots, the coexpressed luc and endogenous glyceraldehyde phosphate dehydrogenase (GAPDH) transcripts were coprecipitated poorly (Fig. 3C), indicating that p54nrb associates with INS-mRNA specifically and is not an abundant component of general mRNP. Quantification of mRNAs revealed that p37gag mRNA was coprecipitated 5 times more efficiently than GAPDH. These data demonstrated that p54nrb is part of soluble INSmRNPs in vivo. Its cytoplasmic association suggested that it may persist during nuclear export, although de novo binding in the cytoplasm could not be excluded.


6622

ZOLOTUKHIN ET AL.

MOL. C

ELL.

B

IOL

.

FIG. 3. p54nrb associates with INS( ) mRNA in vivo. (A) 293 cells were fractionated into cytoplasmic (C), soluble nuclear (N,) and insoluble nuclear (NUP) extracts. Top panels: Western blot analysis with monoclonal antibodies to p54nrb (Transduction Labs) and PSF (Sigma) and with rabbit anti-U2AF35 serum (66), as indicated to the left. Bottom panel: total RNA was extracted from the same fractions, separated on a 15% Tris-borate-EDTA­urea gel, and analyzed on Northern blots for U2 and U5 snRNPs (64). (B) 293 cells were labeled with [35S]methionine and extracted with 0.5 radioimmunoprecipitation assay buffer, and proteins were immunoprecipitated under denaturing conditions with normal or anti-p54nrb rabbit serum (60) as indicated. The sizes of marker proteins are shown (in kilodaltons). (C) 293 cells were cotransfected with 1 g of INS( )-RRE and 0.1 g of luciferase (luc) expression plasmid. At day 2, cell extracts (shown on top) were immunoprecipitated with p54nrb antibodies. The polyadenylated RNA was extracted from immunoprecipitates (bound, B) and from 1:10 aliquots of the supernatants (unbound, U) and analyzed on Northern blots with p37gag, luc, and GAPDH probes, as shown to the right. (D) 293 cells were transfected with 1 g of INS( )-RRE in the presence or in the absence of 0.05 g of Rev expression plasmid and with INS( )M1-10 expression plasmids, as indicated. Cell extraction, immunoprecipitation with p54nrb antibodies, and Northern analysis with p37gag probe were performed as in panel A.

To verify that INS contributed to the specific association with p54nrb, we transiently expressed the INS( ) RRE and INS( )M1-10 mRNAs and compared their coprecipitation with p54nrb in soluble nuclear and cytoplasmic fractions. Figure 3D shows that, in both compartments, the INS( ) mRNA accumulated to higher levels than INS( ) mRNA, in agreement with our previous data (50). However, a proportionally smaller amount of INS( ) mRNA was associated with p54nrb in the cytoplasmic complexes. We next asked whether Rev regulation, known to counteract the effects of INS, affects the p54nrb-INS association. To this end, INS( )-RRE mRNA was expressed in the presence or in the absence of Rev protein and analyzed as described above. Figure 3D shows that the presence of Rev led to a higher INS( )-RRE mRNA accumulation but to a lower proportion of p54nrb-associated mRNA in the cytoplasmic complexes. These data demonstrated that the p54nrb-mRNA association was negatively affected by mutational inactivation of INS as well as by the functional counteraction of INS by Rev, further confirming that p54nrb bound via INS. These differential effects were more pronounced in the cytoplasmic than in the nuclear mRNPs, suggesting that p54nrb discriminates INS more stringently in this compartment. It is plausible that p54nrb recognized INS directly, because p54nrb and PSF are sufficient for recognition in vitro (Fig. 2). To probe the association of the PSF subunit with INS, we performed immunoprecipitations as described above with the monoclonal PSF antibody B92 (55), but INS-mRNA was not coprecipitated detectably. We also noted that in denaturing immunoprecipitation, this antibody performed less efficiently compared to p54nrb antibodies (data not shown), which may explain the lack of coprecipitation. Alternatively, we cannot exclude that p54nrb but not PSF binds to INS-mRNA in vivo. Since both subunits bound to INS in vitro with the same affinity

and specificity (Fig. 2), we believe that, in vivo, p54nrb recognizes the INS as part of the p54nrb/PSF heterodimer. Exogenous PSF acts via INS to inhibit the expression of INS-containing mRNA in human cells. Since p54nrb/PSF interacts with INS, we studied its possible role in INS-mRNA downregulation. First, we tested whether the individual subunits are limiting for INS function in cultured human cells. To this end, we studied the effects of exogenous p54nrb and PSF on INS-mRNA expression in 293 cells (Fig. 4). The INS( )RRE and Rev expression plasmids were transfected in the absence or in the presence of the GFP-p54nrb and GFP-PSF plasmids. We found that GFP-PSF strongly inhibited INSmRNA expression, whereas a PSF mutant lacking one of the RNA recognition motifs (GFP-PSF RRM2) was less potent (Fig. 4A). In contrast, GFP-p54nrb reproducibly led to about a 1.5-fold increase of expression. GFP fluorescence measurements of transfected cells confirmed that the different proteins accumulated to similar levels (Fig. 4B and data not shown). Similar results were obtained with various amounts of PSF and p54nrb plasmids (data not shown). We concluded that exogenous PSF inhibited INS-mRNA expression, whereas p54nrb was not limiting. One explanation is that the inhibition was mediated via PSF only. It is also possible that p54nrb can act as an inhibitor but its endogenous levels were saturating and already producing the maximal effect. The RRM2 domain of PSF contributed to inhibition, suggesting its involvement in the interactions with INS. Alternatively, since the RRM2 mutation disrupted the localization of PSF to nuclear foci (18), the effect may be due to mislocalization of the mutant protein. To confirm that PSF acted via INS, we studied its effects on INS( ) mRNA and found that both the wild-type and RRM2 proteins had a much lesser effect on the expression of the INS( )M1-10 mutant (ranging from zero to 50% inhibition in individual experiments shown in Fig. 4A and C), whereas the


V

OL

. 23, 2003

DOWNREGULATION OF HIV-1 EXPRESSION BY PSF

6623

FIG. 4. Exogenous PSF acts via INS to inhibit INS-mRNA expression. 293 cells were transfected with 1 g of INS( )-RRE in the presence or in the absence of 0.05 g of Rev expression plasmid or with 1 g of INS( )M1-10 expression plasmid. (A to C) Transfections were performed in the absence (mock) or in the presence of 1.5 g of GFP-PSF plasmids. At day 2 posttransfection, p24gag production was measured, and the average values from triplicate plates were normalized to those obtained in the absence of PSF plasmids (100%) and plotted on the x axis (A and C). Panel B shows the normalized fluorescence levels of coexpressed GFP-PSF proteins for the experiment shown in panel A. The average values from triplicate plates are plotted on the x axis as arbitrary units. Bars, standard deviations. Similar data were obtained in several independent transfection experiments. Two representative, independent experiments are shown in panels A and C. (D) Transfections were performed as in panels A and B. At day 2, poly(A)-containing RNA was extracted from the nuclear and the cytoplasmic fractions and analyzed on Northern blots with a p37gag probe.

presence of the intact INS always led to a 10-fold-stronger inhibition in numerous independent transfections. Since both the INS( ) and INS( ) mRNAs were transcribed from the same promoter, we concluded that PSF affected the expression of INS( ) mRNA at the posttranscriptional level. PSF was able to counteract the Rev regulation (Fig. 4) and hence acted in a dominant manner over Rev-CRM1. To test whether PSF acts before or after Rev binding, we studied its effect on INS( )-RRE mRNA in the absence of Rev regulation. Figure 4C shows that PSF strongly inhibited the expression of INS( )-RRE mRNA in the absence of Rev but did not significantly affect INS( ) mRNA expression. Although, as expected, the p24gag va