... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...

Еще в разделе: (Показать все результаты (>5) - vernov-relec.sinp.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>21) - curl.sai.msu.ru/ )

• atmos 3.0 page

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>27) - mph.cmc.msu.ru/ )

• http://mph.cs.msu.ru/mph/pap/txt/fedotov.doc
• MPH-CMC-MSU

... Simultaneous measurement of characteristics of bending and valence bands of water in D2 O solutions, KBr and KCl and using genetic algorithms in conjunction with variation methods allowed increasing accuracy of estimation of Fermi resonance coupling constant and of Fermi resonance contribution into formation of water Raman valence band. ... This energy transfer can explain existence of the shoulder in low-frequency part (in the region 3300 cm-1 ) of water Raman valence band. ...

Еще в разделе: (Показать все результаты (>33) - rswater.phys.msu.ru/ )

• Group of laser spectroscopy of solutions of supramolecular compounds and
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

Sternberg astronomical institute activities on site testing programs review Victor Kornilov comprehensive/characterization/of/astronomical/sites > kislovodsk/russia/2010/october/4-9 > Introduction This presentation responds on our activity in 5 last years only, inspite of that in SAI site testing researches have been started many years ago. ... More detailed discussion is devoted to MASS and DIMM measurements processing, some additional effects which were taken in account in last year. ...

Еще в разделе: (Показать все результаты (>16) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf
• http://site2010.sai.msu.ru/static/doc/AOtarola_site2010.pdf
• Methods and instruments to measure/monitor major site properties

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations
• Pressure Distribution Peculiariry Along Square Canopy

... Phosphomimicking mutations of human 14-3-3zeta affect its interaction with tau protein and small heat shock protein HspB6. ... Effect of phosphomimicking mutations of 14-3-3zeta on its interaction with phosphorylated shortest isoform of human tau protein and phosphorylated human small heat shock protein HspB6 (Hsp20) was analyzed. ... The mutation mimicking phosphorylation of Ser184 does not markedly affect interaction with tau protein and improves the interaction of 14-3-3 with HspB6. ...