... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...

Еще в разделе: (Показать все результаты (>1010) - monkey.belozersky.msu.ru/ )

• About COGs
• About this project

... Attention Eurasian Undergraduate Students. IREX is pleased to announce the 2003 FREEDOM Support Act Undergraduate Program (FSAU). The deadline for this application is October 31, 2002. The program provides opportunities to first-, second-, and third-year undergraduate students from Armenia, Azerbaijan, Belarus, Georgia, Kazakhstan, Kyrgyzstan, Moldova, Russia , Tajikistan, Turkmenistan, Ukraine, and Uzbekistan for non-degree study in the United States for one academic year. ...

Еще в разделе: (Показать все результаты (>33) - suny.msu.ru/ )

• Центр по делам России и США :: Новости
• Center on Russia and the United States :: Currently available grants
• Center on Russia and the United States :: News Archive

... Inorganic Materials Sciences . ... At the same time at the Faculty of Physics and Mathematics of the Moscow University was founded the Inorganic Chemistry Division which was later transformed into a separate Department of Inorganic Chemistry of the MSU Faculty of Chemistry . ... The latter part of this program is successfully realized at both the Deartment and at the Department of Materials Sciences , the new faculty of MSU, which creation was initiated by the department of Inorganic Chemistry. ...

Еще в разделе: (Показать все результаты (>83) - www.inorg.chem.msu.ru/ )

• Joint Semiconductors Surface Study group
• Inorganic Synthesis Laboratory
• The Sheelkov group

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>20) - ecfs.msu.ru/ )

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Конференции . ... Новости для выпускников . ... База данных выпускников . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Место для он-лайн общения выпускников факультета ВМиК МГУ. ... Тема "Ph.D. in economics at Emory University" . ... I'm the Director of Graduate Studies and Associate Professor in the economics department at Emory University (Atlanta, GA, USA). ... We want to recruit the best students to our Ph.D. program. ...

Еще в разделе: (Показать все результаты (>1019) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Виза F-1 для студентов в США
• Клуб выпускников МГУ: Исследовательские стипендии и гранты в США и Канаде.
• Клуб выпускников МГУ: Обсуждение материала "Главой московского офиса Adobe стал

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>31) - erg.biophys.msu.ru/ )

• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики
• nano ERG Research Group: Лаборатория теоретической биофизики
• Constructing discrete Laplacian via sparse matrix ERG Research Group:

... Applied Mycology (Lectures and Practical Course) . ... Fungal Ecology (Lectures and Practical Course) . ... Mitotic Fungi ( Fungi Imperfecti ) (Lectures and Practical Course) . ... Cytology of Fungi and Algae (Lectures and Practical Course) . ... Taxonomy of Algae (Lectures and Practical Course) . ... Zvenigorod MSU Biological Station (Moscow region): Fungi, Aquatic Algae, Aquatic Invertebrates, Myxomycetes; . ... Zvenigorod MSU Biological Station (Moscow region): Fungi and Algae Ecology. ...

Еще в разделе: (Показать все результаты (>334) - herba.msu.ru/ )

• Stability of leaf form and size during herbarization
• Algologia. Vol. 7, No. 2

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>22) - site2010.sai.msu.ru/ )

• Information

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>24) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf
• http://antares.sinp.msu.ru/docs/MAM%202011%20-%20Katya.pdf

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>8) - www.students.chemport.ru/ )

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>26) - cdfe.sinp.msu.ru/ )

• CDFE => Team
• CDFE ? NEA DB
• CDFE - Centre for Photonuclear Experiments Data - Home page

... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...

Еще в разделе: (Показать все результаты (>52) - ecology.genebee.msu.ru/ )

• Персональные страницы

e-mail: polevik@rambler.ru) , , , Management, Control systems, research management systems , . ... The above applies to the study of administration systems with a view to improving them. The greatest effect, as the author says, - can be gained only by scientific approach, which involves the study of the objective tendencies of development, analysis of the causes and factors of problem, anticipating the consequences of their permits, etc. and should include the empirical material. ...

Еще в разделе: (Показать все результаты (>120) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/4/04.pdf

The Department of Talented Youth Affairs and Professional Orientation . ... Law graduates turned in a good performance in the competition ?Foreign Direct Investment Arbitration Moot? ... November 30, 2015, an interactive roundtable meeting on ?Problems of continuous psychological and educational support of gifted children: domestic and foreign experience? was held. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>73) - talant.msu.ru/ )

• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |
• MSU Football Championship | The Department of Talented Youth Affairs and

... PE8_10 Production technology, process engineering PE8_11 Product design, ergonomics, man-machine interfaces PE8_12 Lightweight construction, textile technology PE8_13 Industrial bioengineering PE8_14 Industrial biofuel production PE9 Universe sciences : astro- physics / chemistry / biology ; solar system; stellar, galactic and extragalactic astronomy, planetary systems , cosmology; space science , instrumentation PE9_1 Solar and interplanetary ...

Еще в разделе: (Показать все результаты (>37) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/call_SyG_2012.pdf
• http://ideas.msu.ru/news/19_10_2010/Results_PE.pdf
• http://ideas.msu.ru/news/19_10_2010/Results_country.pdf