VGLukianov2008@yandex.ru) н н н н нн н н , social phenomenon, socio-cultural phenomenon, a social and cultural world, value, meaning, norm, culture, the supreme trinity of values .. The article reveals a specified change of P.A. Sorokin's conceptual priorities in connection with his development of integralistic sociology on the basis of the theory of value, which allowed the Russian-American sociologist to explain the problems of society and culture development with new axiological positions. ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2012/1/12.pdf -- 126.6 Кб -- 03.11.2012
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2012/1/12.pdf -- 126.6 Кб -- 12.01.2015 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Throughout the pap er by a four-valent graph we mean the following generalization: a finite 1-complex with each connected comp onent b eing homeomorphic either to a circle or to a four-valent graph; by a vertex of a four-valent graph we mean only vertices of those comp onents which are homeomorphic to four-valent graphs, and by edges we mean b oth edges of four-valent graphs and circular comp onents (the latter will b e called cyclic edges). ... A free knot is a 1-comp onent free link. ...
[
Текст
]
Ссылки http://dfgm.math.msu.su/files/0articles/Ilyutko/0904.2862v1.pdf -- 119.5 Кб -- 21.08.2009 Похожие документы
. The Camtasia Studio video content presented here requires JavaScript to be enabled and the latest version of the Macromedia Flash Player. If you are you using a browser with JavaScript disabled please enable it now. Otherwise, please update your version of the free Flash Player by downloading here . 2006-2010 Автор инструкции Миняйлов В.В. 2006-2010 Химический факультет МГУ имени М.В. Ломоносова .
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
. Если у вас уже есть настроенный аккаунт и вы просто хотите убедиться в том, что все ваши настройки удовлетворяют требованиям системного администратора, то сравните их с нижеприведенными слайдами. Особое внимание обратите на то, стоит ли у вас флажок напротив опции "This server requires a secure connection (SSL)" . В случае, если вы создаете свой аккаунт "с нуля" загляните сначала сюда , а потом, при необходимости, возвратитесь на эту страницу. Back Next
INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE February 26 - March 05, Moscow, Russia ORGANIZED by Moscow State University, Institute of Mechanics of MSU and Faculty of Mechanics and Mathematics. ... SPONSORED by Russian Foundation for Basic Research, Moscow State University, Institute of Mechanics of MSU. ... Prospective participants must send abstracts in Word to the Organizing Committee (gertsens@imec.msu.ru) not later than 15 January 2006. ... Phone, E-mail and Fax number. ...
... Форумы > Разное > Тема . ... Форумы Список тем Новая тема . ... На какую зарплату рассчитывать студенту? В ходе анализа 4000 резюме, размещенных 19-21 летними студентами на сайте job.ru в 2001-2002 годах в разделе 'Информационные технологии и интернет' получены следующие данные. Возраст Средняя минимальная зарплата . 19 163 (684 человека) . 20 203 (1168 человек) . ... Internet Site Administrator . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...
Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...
... Grant of the Russian Foundation for Basic Research (RFBR) No. 16-32-00882 for 2016-2017 "The creation of fluorescent biomarkers on the basis of nanodiamonds and optimization of their properties for targeted delivery of drugs and monitoring their excretion" (headed by K. A. Laptinskiy) . ... Grant of the Russian Foundation for Basic Research (RFBR) No. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...
... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...
... Классификация программ (системные, прикладные). ... Роль операционной системы в создании абстрактного представления компьютера для прикладных задач. ... Концепции Microsoft Windows . ... Буфер обмена: его назначение и примеры использования. ... Назначение программы. ... Решение уравнений средствами Microsoft Excel. ... Программирование. ... Microsoft Visual Basic .Net Express Edition. Ввод и редактирование текста программы на языке Visual Basic . ... Основы программирования на Visual Basic. ...
Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... THEORETICAL BASES AND EXPERIMENTAL ANALYSIS OF SOIL SOLUTION TRANSFORMATION UNDER INDUSTRIAL POLLUTION AND REHABILITATION OF SOILS . ... Transformation of soils solutions under air pollution impact. ... Prediction of soil solution changes in response to soil contamination and rehabilitation with dynamic bigeochemical models. The project aims to study, both theoretically and experimentally, response of soil solutions to contamination/remediation of soils by/from heavy metals. ...