... The author points to the potential value of an investigation of Prescriptivism not limited to the problems specific to a single language. Key words: Prescriptivism, standard language, comparative linguistics. ... No one felt competent to judge the quality or correctness of anyone else's use of the language. ... So when comparing usage problems in more than one language, one must consider both the possibility of a formal analogy and the possibility of a functional analogy. ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/research/vestnik/4-2011-Ilson.pdf -- 139.5 Кб -- 02.02.2013
[
Текст
]
Ссылки http://ffl.msu.ru/research/vestnik/4-2011-Ilson.pdf -- 139.5 Кб -- 25.02.2013 Похожие документы
. Backlinks to VarNOP in all Webs ( Search System Web only ) . VarSTARTSECTION . #VarSTARTSECTION STARTSECTION marks the start of a section within a topic * Section boundaries are defined with %STARTSECTION{}% and %ENDSECTION{}%. * Sections ... NEW - 08 Dec 2010 - 18:30 by ProjectContributor . Number of topics: 1 . Number of topics: 0 . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? Send feedback
VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...
... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...
Автор модели командных ролей в менеджменте выступил с докладом перед студентами и выпускниками ВШБ МГУ . ... С докладом на тему Эволюция поведения людей и ее значение для будущего ( Evolution of Human Behaviour and its Bearing on the Future ) выступил Рэймонд Мередит Белбин (Великобритания) доктор психологических наук, создатель теории и модели Роли в команде менеджеров . ... Р.М. Белбин является автором 11 книг по менеджменту, среди них такие издания, как . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Keywords: anthropology, primatology, hamadryas baboons, rhesus monkeys, manipulatory activity, cognitive abilities Short Communications Korsakov A.V., Troshin V.P., Sidorov I.V., Zhilin A.V., Mikhalev V.P. Features of the cytogenetic status of women in labor with congenital developmental anomalies of the fruit, living in conditions of chemical pollution of atmospheric air (p. 103) Research objective. ... Technological analysis was used in this research as the main approach. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2013_4.doc -- 52.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2013_4.doc -- 52.5 Кб -- 23.07.2015 Похожие документы
... Sur le CEI . ... Condition d??tudes . ... Votre demande d inscription doit galement inclure une copie des premi res pages de votre passeport. ... L enseignement au Centre est en russe selon les plans d tudes et les programmes du Centre. ... Nos tudiants peuvent utiliser la biblioth que, les collections audio et vid o du Centre, ainsi que d acheter les mat riels d tude exig s. Le CIE fournit aux tudiants les documents officiels n cessaires, v rifiant leur statut en tant qu tudiant de l Universit . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
... NetCDF User's Guide for C . ... 2 - Components of a NetCDF Dataset . ... 2.4 - Attributes . ... 3.1 - netCDF external data types . ... 7.5 - Write a Single Data Value: nc_put_var1_ type . ... 7.10 - Read a Single Data Value: nc_get_var1_ type . ... 7.12 - Read an Array of Values: nc_get_vara_ type . 7.13 - Read a Subsampled Array of Values: nc_get_vars_ type . 7.14 - Read a Mapped Array of Values: nc_get_varm_ type . ... 7.16 - Fill Values . ... 8.4 - Get Attribute's Values:nc_get_att_ type . ...
... Главная Факультет политологии Новости факультета Новость . ... 17 ноября на факультете политологии МГУ имени М. В. Ломоносова состоялась лекция директора программы?Россия и Евразия? Центра стратегических и международных исследований Эндрю Качинса ?Putin the Politician: The Evolution of his Domestic Political Strategy for Success from 2000 to 2015?. ... Расписание экзаменов . Факультет . ... Поступление на факультет политологии в 2016 году . ... Информация о переводе на факультет политологии . ...
Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...
[
Текст
]
Ссылки http://iconolat13.phys.msu.ru/ICONO_LAT-2013/Guidelines_files/Meetings-Style-Guide.pdf -- 128.6 Кб -- 26.01.2013 Похожие документы
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
ДВОЙСТВЕННЫЕ ЗАДАЧИ УПРАВЛЕНИЯ И НАБЛЮДЕНИЯ ДЛЯ ВОЛНОВОГО УРАВНЕНИЯ Dual Control and Observation Problems for the Wave Equation Специальный курс для студентов 3-5 курса и аспирантов Лекции - 32 часа Форма контроля - экзамен Кафедра оптимального управления Автор программы: профессор Потапов М.М . Лекторы: профессор Потапов М.М . Аннотация Для волнового уравнения с переменными коэффициентами рассматриваются двойственные постановки задач ... Примеры задач граничного управления. ...
[
Текст
]
Ссылки http://oc.cs.msu.su/download/99/DCOP_program_2011.doc -- 36.5 Кб -- 09.04.2016
[
Текст
]
Ссылки http://oc.cs.msu.ru/download/99/DCOP_program_2011.doc -- 36.5 Кб -- 01.10.2012 Похожие документы
Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...
... education . research . ... Fundamentals of Nanotechnology . ... Molecular physiology . ... Pass/fall exam: 5 p.m., 22 May, 2009 (those third-year students who pass the exam undertake further study majoring in Nanosystems and Nanodevices , Functional Nanomaterials , Nanobiomaterials and Nanobiotechnology). ... 10 February 2009 . ... Prof. Yu. ... Work of molecular motors: ATP synthetase, photosynthetic reaction centers, retinal containing photosensitive proteins (rhodopsin, bacteriorhodopsin.) ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the