JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...

Еще в разделе: (Показать все результаты (>20) - beams.chem.msu.ru/ )

... education . research . ... Fundamentals of Nanotechnology . ... Molecular physiology . ... Pass/fall exam: 5 p.m., 22 May, 2009 (those third-year students who pass the exam undertake further study majoring in Nanosystems and Nanodevices , Functional Nanomaterials , Nanobiomaterials and Nanobiotechnology). ... 10 February 2009 . ... Prof. Yu. ... Work of molecular motors: ATP synthetase, photosynthetic reaction centers, retinal containing photosensitive proteins (rhodopsin, bacteriorhodopsin.) ...

Еще в разделе: (Показать все результаты (>17) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по
• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ­ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf

... 281 The Dating of Ptolemy's Almagest Based on the Coverings of the Stars and on Lunar Eclipses A. T. FOMENKO Department of Geometry and Topology, Faculty of Mathematics and Mechanics, Moscow State University, 119899, Moscow. ... Dating, latitude, longitude, star coverings, lunar eclipses. ... The Dating of the Lunar Eclipses The 21 lunar eclipses mentioned in the Almagest were observed by different astronomers approximately during the time interval from 26 till 881 years of Nabonassar. ...

Еще в разделе: (Показать все результаты (>116) - hbar.phys.msu.ru/ )

• Ответ Wally на книгу "Крах С14"
• The jump of the second derivative of the moon's elongation

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>5) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Local similarities and pairwise sequence alignment . ... Multiple sequence alignment . ... This includes representation in corresponding databases of information about structurally and functionally important fragments and patterns, taking into account obtained statistical information about sequences and three-dimensional structure data. ... The alignment procedure for each shift of the sequences finds in the local similarity map a series of non-overlapping diagonal segments and computes its power. ...

Еще в разделе: (Показать все результаты (>165) - www.genebee.msu.ru/ )

• DIMACS Series in Discrete Mathematics and Theoretical Computer Science Volume
• BioSystems, 30 (1993) 57-63 57
• Picornaviruses: discovering big in small

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>10) - www.hist.msu.ru/ )

• Editions
• Instrumenta

... International Studies . ... Russian Language Program . ... Professor Svetlana Grigor evna Ter-Minasova is a leading foreign language specialist and teacher, who has built up a formidable international reputation. ... At present professor Svetlana Ter-Minasova is President of the Faculty of Foreign Languages and Area Studies at Lomonosov Moscow State University, Russia, and Professor Emeritus in the University. ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ...

Еще в разделе: (Показать все результаты (>138) - ffl.msu.ru/ )

... О UNИX . ... ApacheWithModPython . ... Why Use mod_python . ... The sample configurations below are for a wiki instance called mywiki installed in a directory /var/www/moin/mywiki with the main MoinMoin installation installed in python's default site library path. ... Add a Location directive: <Location /mywiki> SetHandler python-program # Add the path of your wiki directory PythonPath "['/var/www/moin/mywiki'] + sys.path" PythonHandler MoinMoin.request.request_modpython::Request.run </Location> . ...

Еще в разделе: (Показать все результаты (>107) - uneex.mithril.cs.msu.su/ )

• Meetings/Murray - UNИX
• HelpOnInstalling/ApacheOnWin32 - UNИX
• WhyWikiWorks - UNИX

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Visa to entry Russia

... Sur le CEI . ... Condition d??tudes . ... Votre demande d inscription doit galement inclure une copie des premi res pages de votre passeport. ... L enseignement au Centre est en russe selon les plans d tudes et les programmes du Centre. ... Nos tudiants peuvent utiliser la biblioth que, les collections audio et vid o du Centre, ainsi que d acheter les mat riels d tude exig s. Le CIE fournit aux tudiants les documents officiels n cessaires, v rifiant leur statut en tant qu tudiant de l Universit . ...

Еще в разделе: (Показать все результаты (>261) - www.cie.ru/ )

• Le Centre de l'?ducation International :: L'Universit? de l'?tat de Moscou M.
• Logement :: Condition d??tudes :: CEI
• Inscription :: Condition d??tudes :: CEI

... Distances between sequences . It is considered that the space, where all amino acids and sequences are analysed, is a metric one. ... When the distance between amino acids is entered, it is rather easy to consider such measure as pair distance between sequences in any position of alignment (in fact, this distance is just a distance between two amino acids). As distance is an additional quantity, pair distance between sequences on all alignment positions can be easily defined. ...

Еще в разделе: (Показать все результаты (>36) - monkey.belozersky.msu.ru/ )

• About this project
• About authors ot this complex
• Inquiry information || Parsimony algorithm

... 247th American Chemical Society National Meeting and Exposition "Chemistry and materials for energy" , March 16-20, Dallas, TX Talk: A.V. Nemukhin "QM/MM-based modeling of structure and spectra of fluorescent proteins" . ... IV International Symposium "Topical Problems of Biophotonics", July 21-27, Nizhny Novgorod Invited talk: M.G. Khrenova , A.V. Nemukhin, A.P. Savitsky "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ...

Еще в разделе: (Показать все результаты (>22) - lcc.chem.msu.ru/ )

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

196. http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc

197. http://lav01.sinp.msu.ru/~vlk/report_E852.ps

198. SWX - Главная

199. http://tex.bog.msu.ru/rustexeo.html

200. Archive