... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
... Personal Data 1.1 1.2 1.3 1.4 1.6 1.8 1.9 Name First Name Other Names (//) Date of Birth (d/m/y) Place of Birth Passport (//) Passport issued (d/m/y) / , / / 1.5 1.7 Sex Citizenship M/M /F / 1.10 valid till / / 2. ... Sending Institution 4.1 4.2 4.3 Ti t l e Faculty / Year / Program / Undergraduate Student / Bachelor course / PhD Student / Other: / Master course 5. Language Skills1 5.1 5.2 5.3 5.4 Russian English Other Necessity for Russian Courses at MSU Certificate to be presented 1 , . ...
[
Текст
]
Ссылки http://www.msu.ru/int/stazh/MSU_exchange.pdf -- 86.6 Кб -- 01.02.2012
[
Текст
]
Ссылки http://www.philol.msu.ru/data/foreign/anketa.pdf -- 86.6 Кб -- 29.01.2009
[
Текст
]
Ссылки http://www.ied.msu.ru/files/MSU_exchange_application_2008.pdf -- 86.6 Кб -- 20.11.2008 Похожие документы
... Co-Chair , ICONO/LAT 2013 . Director, Institute of Laser Physics . ... Russia . ... Conference venue . Moscow, Russia . Program overview . Program topics . ... Advance program . ... Visa to entry Russia . ... ICONO/LAT conference is the leading event in the area of quantum electronics, laser physics, and their applications. ... You are greatly welcome to attend the ICONO/LAT 2013 conference in Moscow, Russia. ... International Laser Center, M.V.Lomonosov Moscow State University . ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Мы ведем преподавание дисциплины Программирование и решение задач на ЭВМ для первокурсников; сопровождаем компьютерные классы, которые используют в учебной работе различные кафедры факультета , а часть времени выделена для самостоятельной работы студентов, аспирантов и сотрудников ; осуществляем техническое администрирование сети chem.msu.su ; консультируем преподавателей и сотрудников факультета в области вычислительной техники; ...
Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...
Volume 18, number 3 P HYS ICS LETTERS 1 September 1965 PROTON SCATTERING FROM A TUNGSTEN SINGLE CRYSTAL A. F. TULINOV, V. S. KULIKAUSKAS and M. M. MALOV Institute of Nuclear Physics, Moscow University, Moscow, USSR Received 26 July 1965 Usually amorphous or polycrystalline targets are u s ed fo r stu d y in g n u c lear reactio n s in itiated by accelerated particles. ... 306 Vol ume 18, numbe r 3 P HYS ICS LETTERS 1 September 1965 Fig. ... B.Domeij and K.Bjorkqvi st, Phy s ics Letters 14 (1964) 127. ...
Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Центр коллективного пользования . МГУ им. М.В. Ломоносова . ... Главная страница . О центре . ... Уже несколько лет в МГУ действует Центр коллективного пользования, объединивший передовые лаборатории естественнонаучных факультетов МГУ, в распоряжении которых имеется самое современное оборудование. ... Центр коллективного пользования МГУ им. М.В. Ломоносова, 2009 . ...
... The results of neutron diffraction, inelastic and quasielastic neutron scattering studies on mixed crystals K 1-x (NH 4 ) x H 2 PO 4 will be presented. The anomalous behaviour of the proton glass system which is formed for ammonium concentration 0.2<x<0.8 is compared with the relevant properties parent ferroelectric KH 2 PO 4 and antiferroelectric NH 4 H 2 PO 4 crystals. ... a) influence of the proton glass transition on crystal structure; . ...
... Department of Vertebrate Zoology . M.A.Menzbir - member of the SU Academy of Sciences (1929), rector of the Moscow University (1917-1919), founder of Institute of Comparative Anatomy (1908 -1909), one of the founders and Head of Comparative Anatomy Department (1885-1912), founder of phylogenetic anatomy, modern bird systematics, ornithology, historical and regional zoogeography, faunogenesis theory. ... Headed the united Vertebrate Zoology and Comparative Anatomy Department from 1931 to 1951. ...
. ИМЕЕТСЯ РУССКАЯ ВЕРСИЯ . Moscow State University . Chamber Orchestra . founded in 1967 by Edward Gindin . music director, Alexander Konstantinov . About the Orchestra . MEMBERS: . 201 5 /201 6 season . Alia . RECITALS: . Concert Schedule . Audio/Video Records . Some Other Interesting Sites . Natalya Atsarkina , site administrator ( e-mail: azarkina@yahoo.com ) . The homepage was founded in September, 1999 . Lastly updated in March 22, 201 6 . This site is a member of WebRing. To browse visit Here .
M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
The %INCLUDE{...}% macro embeds the content of the specified topic at the place where the INCLUDE is used. The whole content or only parts of of a page can be included. ... Syntax Example . ... Include a topic . ... You need to make sure that the integrity of a web page is not compromised; for example, if you include a table, make sure to include everything including the table end tag. ... This topic: System > WebHome > ReferenceManual > UserDocumentationCategory > IncludeTopicsAndWebPages . ...
The %INCLUDE{...}% macro embeds the content of the specified topic at the place where the INCLUDE is used. The whole content or only parts of of a page can be included. ... Syntax Example . ... Include a topic . ... Include a topic MyTopic with two parameters . INCLUDE{ "page" pattern="reg-exp" rev="2" warn="off" section="clients" PARAMETER1="value" PARAMETER2="Some value" }% . ... This topic: System > WebHome > ReferenceManual > UserDocumentationCategory > IncludeTopicsAndWebPages . ...
Cell Biology International 27 (2003) 293294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf -- 67.3 Кб -- 04.03.2004 Похожие документы
V.A. Khokhlova, M.R. Bailey, P.J. Kaczkowski, B.W. Cunitz, J. Reed, M. Nakazawa, and L.A. Crum. ... V.A. Khokhlova. ... O.A. Sapozhnikov, R. Cleveland, M.R. Bailey, L.A. Crum. ... V.A. Khokhlova, M.A. Averkiou, M.A. Bailey, and L. A. Crum. ... V.A. Khokhlova, P.J. Kaczkowski, B.W. Cunitz, M.R. Bailey, and L.A. Crum. ... In: Book of Abstracts of the, 3.32B. V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum. ... A.E. Ponomaryov, V.A. Khokhlova, M.A. Averkiou, and L.A. Crum. ...
... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...