... The Dynamic Characteristics of GPS Time Series and their Relation to the Seismotectonic Specific Features of a Region V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, Russia e mail: vszakharov@yandex.ru Received October 23, 2012 Abstract--The noise component in the time series of Earth surface displacements that were obtained with the Global Positioning System (GPS) is analyzed for 19 points. ... These facts affect the values of the investigated fractal characteristics. ...
[
Текст
]
Ссылки http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_2_eng.pdf -- 380.5 Кб -- 18.10.2013 Похожие документы
INNER POLAR RINGS REGULAR LENTICULAR GALAXIES 1 K. Sil'chenko 2 Sternberg Astronomical Institute, 119992 Moscow, Russia; Isaac Newton Institute Chile, Moscow Branch; olga@sai.msu.su Afanasiev Special Astrophysical Observatory, 369167 Nizhnij Arkhyz, Russia; vafan@sao.ru Received 2003 December accepted February 4 ABSTRACT have investigated a sample of galaxies, mostly with circumnuclear dust lanes orthogonal their major axes, chosen from Hubble Space Telescope Wide Field Planetary Camera 2 images. ...
... Механико-математический факультет МГУ и Группа Доверенных Вычислений (Trusted Platform Group 1;, TCG) 25 июня 2012 года проводят совместный научно-практический семинар по Доверенным и Безопасным Вычислениям. ... a. Научные доклады преподавателей и научных сотрудников Механико-Математического факультета МГУ (возможны доклады и других факультетов с учетом тематики семинара), . ... Информацию и материалы Группы Доверенных Вычислений (TCG) можно найти на сайте http://www.trustedcomputinggroup.org/ . ...
... 1 The publication of this monumental work provides an appropriate occasion for reexamining the meaning of certain problematic Luwian lexemes and constructions. ... Hieroglyphic Luwian (HLuw.) remained the only written language in Anatolia for several centuries, until the conquest of Neo-Hittite states by Assyria and possibly the spread of alphabetic writing brought an end to the hieroglyphic scribal tradition. ... A very cautious approach is adopted with regard to translation. ... VAS")a-tara/i-i-na...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf -- 1120.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf -- 1120.0 Кб -- 30.04.2010 Похожие документы
... Форумы > Аспирантура > Тема . ... Аспирантура в Англии по машинному обучению . Если Вас интересует аспирантура в Англии по теме 'Машинное обучение' (с большим весом математических методов: функциональный анализ, теория вероятностей,...), пожалуйста свяжитесь со мной: vovk@cs.rhul.ac.uk (Владимир Вовк). ... Название проекта, в рамках которого ищется аспирант, - 'Practical competitive prediction' (funded by EPSRC). ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...
... Not until everyone ... by the Customs Authorities were passengers allowed to enter the country. had searched . ... Were ... being robbed . ... Peter is not ... he seems. so self-confident like . ... The more you read in English, .... your command of the language will be better . will be better your command of the language . the better your command of the language will be . your better command of the language will be . ... The food is ... and it tastes .... quite expensive ... badly . ...
XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...
University Satellites and . Space Science Education . ... Two micro-spacecraft constellation with solar sails partially compensating the solar gravity allow their placement in the points along the Sun-Earth line behind the standard L1 point, i.e. further out from the Earth and closer to the Sun. The distances of the placement from the Earth and the base distances between such satellites depend on the ratios of their mass to the sail area. ...
... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Programs . ... Faculty in the people . ... Two Master?s programs are carried out at the faculty ? ... In 2012 Lomonosov Moscow State University received the license to carry out educational activities with a specialization 074301 Producer?s Business . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... История лаборатории КГЭ . Лаборатория КГЭ сегодня . ... Информация для студентов 1-3 курсов . Информация для студентов 4 курса . ... Доступ к почтовым ящикам сотрудников из web-браузера . ... Различия между MailMan Standard Edition и Professional Edition . Почтовая система Endymion MailMan Standard Edition . Почтовая система Endymion MailMan Professional Edition . Почтовая система OpenWebMail . ... Лаборатория катализа и газовой электрохимии | ...
. Cайт превышает предел нагрузки на процессор . приобретенного тарифного плана хостинга. Попробуйте зайти позже. Site exceeds CPU load allowed by purchased hosting plan. Please try again later. Владельцу сайта: . описание ситуации на странице www.1gb.ru/autolimit .
... 4, No. 5 (2006) 10331056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602608, 1993. ...
... The results are compared to the hydration curves, fatty acid composition and the structure-dynamic and functional characteristics of the membranes of photosynthetic bacteria Rb. sphaeroides, Rhodospirillum rubrum and Ectothiorhodospira shaposhnikovii. ... Based on the results obtained and the data on model systems, four stages of hydration process are distinguished with different effects on the structure and dynamics of membrane components. ...
... Chem. ... 9, 125820 Moscow, Russia ReceiVed December 13, 1999 Abstract: Orthometalated aryl oxime complexes cis-(C,S)-[PtII(C6H3-2-CMedNOH-5-R)Cl(Me2SdO)] (1, R ) H (a), MeO, Me, F, and Cl) undergo deoxygenation of dimethyl sulfoxide ( DMSO ) in methanol in the presence of HCl to afford the Pt(IV) dimethyl sulfide complexes fac-[PtIV(C6H3-2-CMedNOH-5-R)Cl3(Me2S)] (2), the composition of which was confirmed by an X-ray structural study of 2a. The mechanism ... AlexandroVa et al. complexes. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... A particularly interesting family of examples are given by the weighted projective spaces CP n (), which depend upon a vector of positive integral weights (0 ,...,n ) for their definition. ... Nevertheless, the ultimate goal is to outline recent work with Tony Bahri and Matthias Franz, in which we compute the equivariant integral cohomology ring HT (CP n ()), with respect to the action of the standard compact n-torus T < (C \ 0)n . ...
[
Текст
]
Ссылки http://pont2008.cs.msu.ru/files/en/abstracts/Ray.pdf -- 41.6 Кб -- 07.01.2008
[
Текст
]
Ссылки http://pont2008.cmc.msu.ru/files/en/abstracts/Ray.pdf -- 41.6 Кб -- 07.01.2008 Похожие документы
... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf -- 233.1 Кб -- 06.07.2014 Похожие документы
... It is sometimes called the `thermoelectric figure-of-merit,' although this name is more often given to the dimensionless combination ZT sS 2 T X K In the above formulas, s, S, and K are respectively the material electrical conductivity, thermopower (Seebeck coefficient), and thermal conductivity, and T is the operating temperature or the average temperature T1 T2 a2 of the converter, with T1 and T2 being the respective cold and hot end temperatures. ... We first consider the thermal conductivity. ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Dmitriev-Zvyagin-10-Uspekhi-final.pdf -- 257.0 Кб -- 09.02.2011 Похожие документы