Backlinks to VarHTTP in all Webs ( Search System Web only ) . ... Appendix A: Foswiki Development Time line Foswiki Release 1.1.9 19 Nov 2013 Foswiki 1.1.9 was built 18 Nov 2013. ... NEW - 19 Oct 2013 - 03:56 by ProjectContributor . ... VarHTTPS HTTPS get HTTPS headers * The same as %HTTP% but operates on the HTTPS environment variables present when the SSL protocol is in effect. ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. ...

Еще в разделе: (Показать все результаты (>1698) - wiki.cs.msu.ru/ )

• (backlinks in System Web) VarHTTP < System < Foswiki
• (backlinks in all Webs) TipsOfTheDayAdmin < System < Foswiki
• (backlinks in System Web) TipsOfTheDayAdmin < System < Foswiki

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/04/1896%20Arrhenius.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf

Описание вакансии: . Company: Bekaert NV, Zwevegem, Belgium . ... Reporting to/hierarchy: Corporate Technology Manager . Function details: This person will use his/her filtration expertise for the improvement of metal fiber based filter products and processes in close collaboration with the Product Market Managers and Technology Managers of the Business Units. ... He/she will take the necessary actions for the introduction of new applications for Bekaert liquid and gas filters. ...

Еще в разделе: (Показать все результаты (>27) - www.chemport.ru/ )

• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• Fasciculus Chemicus. Arthur Dee

Вертикальное распределение, скорости миграции и модели сравнения для актиния в полузасушливой местности [Нью-Мексико]. ... 2006. ... С. 199-211. ... Представлены результаты наблюдений, выполненных на военно-воздушной базе Карлтлэнд (Нью Мехико). ... Расчеты по диффузионной модели и модели выщелачивания дали близкие результаты скорости миграции актиния в диапазоне 0,009-0,1 см/г, причем более высокие для более глубоких слоев почвы. ключевые слова: . ...

Еще в разделе: (Показать все результаты (>33) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0301000451
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=28&from=&ref_ind=0210000232

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>6) - oc.cs.msu.ru/ )

On the Control of Liouville Equations Roger Brockett School of Engineering and Applied Sciences, Harvard University, USA e-mail: brockett@seas.harvard.edu Some important limitations standing in the way of the wider use of optimal control arise from the difficulty involved in properly weighting the cost of the apparatus required to implement the control in feedback form and from the fact that a control policy will judged on its ...

Еще в разделе: (Показать все результаты (>24) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/KolesovMishchenkoRozov.pdf

... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease ­ , ). ...

Еще в разделе: (Показать все результаты (>4) - www.soc-phys.chem.msu.ru/ )

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The main goal and objective of the elective course "Medical Toxicology" is the training of medical and pharmaceutical students in the field of toxicology. ... Toxicology - the field of science that studies the poisonous (toxic) substances, the potential risk of exposure, mechanisms of their harmful actions, methods of diagnosis, prevention and treatment of diseases developing due to such exposure. ... Факультет фундаментальной медицины Московского государственного университета им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11) - fbm.msu.ru/ )

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... Moscow, April 10-14, 2007 Abstracts . ... An abstract should be prepared in MS Word according to the attached template. ... Abstracts should be sent by e-mail to io@cs.msu.su in an attached file. ... Accepted abstracts will be published in proceedings of the conference. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Welcome - ORM 2007
• Accommodation - ORM 2007
• Contacts - ORM 2007

... Рифабутин, спиропиперидиловое производное рифампицина, не отличаясь от последнего по спектру действия, обладает рядом преимуществ, к числу которых относятся: . ... РБ превосходит РМ по основным фармакокинетическим показателям: он хорошо проникает в ткани и жидкости организма, характеризуется большим объемом распределения, более высоким соотношением концентраций ткани/кровь, более длинным периодом полувыведения (пролонгированное действие). ... АНТИБИОТИКИ И ХИМИОТЕРАПИЯ, 1999-N8, стр. ...

Еще в разделе: (Показать все результаты (>437) - www.nature.web.ru/ )

• Макролиды и фагоцитоз
• Научная Сеть >> Ветер космических странствий
• Поведенческие реакции рыб на болевые стимулы

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 29/09/2015 . ... Natural resousces management? The purpose of the "Natural resources management" Master?s Degree programme is to educate specialists in the field of natural resource management, environmental management, sustainable development of regions and densely urbanized territories. ...

Еще в разделе: (Показать все результаты (>2) - www.hsib.msu.ru/ )

In the three and a half years of itтАЩs existence, the participants of the Ecological Cooperation Project have carried out more than 200 activities towards conserving and protecting the environment. ... Activities: . ... During the "We'll Conserve the EarthтАЩs Beauty" project at the Silicate lakes, near Lipetsk, the waste around a lake and in a forested area nearby was cleaned up. ... The members of ecological club from Gymnasium #1529, in Moscow, had a summer expedition to Solovetsky museum in 1999. ...

Еще в разделе: (Показать все результаты (>15) - www.ecocoop.ru/ )

... 2013 тАФ Academic Writing: Russian and International Experience (Moscow) . ... 2009 тАФ Media Imagination (Moscow) . 2008 тАФ University Among the Media: Innovation in Higher Learning and Changing Modes of Effective Communication (Moscow) . ... 2003 тАФ Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication (Yasnaya Polyana) . 2002 тАФ Popular Literature: American and Russian Experience in Cultural Myth-Making (Moscow) . ... Summer School 2016 . ...

Еще в разделе: (Показать все результаты (>5) - discours.philol.msu.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>166) - www.pereplet.ru/ )

• quake_ru
• Quakes