Бейсбольная команда Государственного университета штата Нью-Йорк (СУНИ) возвращается в Россию . State University of New York Baseball Returns to Russia . ... СУНИ гордится своим университетским партнерством, старейшим как для США, так и для России. С целью развития и распространения студенческих обменов, научных исследований и прочих инициатив в области высшего образования между СУНИ и МГУ три года тому назад в Олбани был открыт Центр по России и Соединенным Штатам. ... мгу-суни . ...
... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf -- 94.8 Кб -- 06.07.2014 Похожие документы
... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...
Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...
... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...
... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...
... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...
Программные средства построения интернет-атласов . ... В работе описывается разрабатываемая в НИВЦ МГУ технология и поддерживающие ее программные средства комплексного отображения разнородной пространственно распределенной информации, в том числе в среде Интернет. ... Описываемая технология состоит в подготовке на инструментальной машине файлов (HTML-страниц, файлов с программами управления данными и их визуальным представлением и файлов данных), представляющих собой Интернет публикацию. ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Created 10 Aug 2008 - 17:36 . ... The preliminary test version of the Automation for Scientific Research Department English edition website has been released. Current content includes general information about the department , list of teachers and researchers , courses of study , contact information and some news. ... Source URL: http://ani.cmc.msu.ru/en/news-2008-08-10-english-edition . ...
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Created 10 Aug 2008 - 17:36 . ... The preliminary test version of the Automation for Scientific Research Department English edition website has been released. Current content includes general information about the department , list of teachers and researchers , courses of study , contact information and some news. ... Source URL: http://ani.cs.msu.su/en/news-2008-08-10-english-edition . ...
Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...
... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...
. This crossword was created with EclipseCrossword - www.eclipsecrossword.com . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . Этот кроссворд был создан freeware EclipseCrossword
... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...
Серверные функции OS/2 . ... Если вы еще не вошли (не зарегистрировались) в системе, то надо запустить "Peer Workstation Logon" и в появившемся окне набрать свое имя (User ID) и пароль (Password). Находим и запускаем "Sharing and Connecting" . ... Например, выберем директорию UTIL на диске D: . ... Определим доступ к вашему ресурсу, нажмите кнопку "Grand access". ... Read only - только чтение . ... В окне "Sharing and Connecting" появится общий ресурс, при необходимости можно создать еще. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
MEIS : 2007 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...