ПЕТРОЛОГО-ТЕРМОМЕХАНИЧЕСКОЕ МОДЕЛИРОВАНИЕ КОНТИНЕНТАЛЬНОЙ КОЛЛИЗИИ В ДОКЕМБРИИ: ГЕОДИНАМИЧЕСКИЙ ЭФФЕКТ МОЩНОСТИ ЛИТОСФЕРЫ В.С. Захаров, А.Л. Перчук, С.П. Завьялов, Т.А. Синева, Д.А. Симонов, Т.В. Геря Многие аспекты докембрийской коллизии остаются неясными из-за неопределенности влияния на геодинамические процессы ряда ключевых физических параметров (температура мантии, мощность литосферы и др.), которые существенно отличались в докембрии по сравнению с современными условиями. ... Vol. ... Vol.140. ...
[
Текст
]
Ссылки http://conf.msu.ru/file/event/3383/eid3383_attach_34245e851b4beca50830629ad7391538ea0e6b5e.doc -- 40.0 Кб -- 20.11.2015 Похожие документы
... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...
... Кафедра физики Земли . ... Исследования процессов генерации магнитного поля Земли и магнетизма горных пород позволяют предположить, что геомагнитное поле существует миллиарды лет, его эволюция тесно связана с эволюцией Земли. ... На решение этих очень важных проблем направлены исследования, проводимые в лаборатории Геомагнетизма кафедры физики Земли под руководством профессора В.И.Трухина. ... Трухин. ... Трухин В.И., Максимочкин В.И. Магнетизм горных пород Земной коры и особенности эволюции Земли. ...
... Звезды типа Миры Кита и полуправильные Среди пульсирующих переменных звезд поздних классов видное место занимают долгопериодические переменные звезды (ДПП). ... Изменения блеска мирид происходят более или менее регулярно, периоды большинства мирид находятся в интервале от 150 до 600 суток ( рис. ... В 4-м издании Общего каталога переменных звезд (ОКПЗ) ДПП (включая переменные типа Миры Кита, или мириды, и полуправильные переменные поздних классов) составляют самую многочисленную группу переменных. ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
G.F.Hoffmann in Moscow . Introduction by M.G.Pimenov . G.F.Hoffmann GENERA PLANTARUM UMBELLIFERARUM Mosquae 1814 . G.F.Hoffmann PLANTARUM UMBELLIFERARUM GENERA Mosquae 1816 . Plant Name Index 1814 & 1816 . G.F.Hoffmann Syllabus Umbelliferarum officinalium 1814 & 1816 . B.M.Koso-Poljannsky To 100-year anniversary of Hoffmann's book "Genera Umbelliferarum" Yuriev, 1914 (in Russian) . S.Yu.Lipschitz G.F.HOFFMANN Moscow, 1940 (in Russian) . Hoffmann's herbarium in MW . ...
... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Welcome to the website of Chair of Computer Methods in Physics! ... methods of analysis and interpretation of experiments (computing and measurements systems theory) . mathematical methods of image analysis and interpretation . methods of fuzzy and uncertain fuzzy . ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ...
... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf -- 1261.4 Кб -- 13.09.2014 Похожие документы
... About hotel . ... Murmansk (in 1916-1917 - Romanov on Murman) - is the largest city in the world, which is situated behind the Arctic Circle. ... In the city there are two regional museums: Murmansk regional museum of local lore and Murmansk regional art museum in which very interesting expositions are exposed. ... The Chinese restaurant "Shanghai" invites guests to taste the dishes, cooked by professional Chinese cooks and to be convinced that Chinese cuisine is one of the best in the world. ...
ґ Universite catholique de Louvain ґ ґ Departement des Sciences economiques ` ґ ґ These presentee en vue de lobtention du grade de ґ docteur en sciences economiques Essays on economic dynamics under heterogeneity Anton O. Belyakov Composition du jury: Julio Davila (promoteur) Raouf Boucekkine Carmen Camacho Vladimir Veliov Mathieu Parenti Acknowledgements First of all I would like to thank my supervisors Raouf Boucekkine and Julio Davila. I'm grateful to other members of my doctoral jury: Mathieu Parenti,
A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...
... Цикл статей «Регулирование активности ДНК-связывающих ферментов» Агапкина Юлия Юрьевна, старший научный сотрудник химического факультета Зацепин Тимофей Сергеевич, научный сотрудник химического факультета 2. статья «Find It If You Can: A Game for Modeling Different Types of Web Search Success Using Interaction Data (Моделирование различных определений ... Цикл статей «Самоаффинные многогранники и аффинные инварианты выпуклых тел. ...
[
Текст
]
Ссылки http://expertise.msu.ru/sites/default/files/2012_deripaska_results.doc -- 151.5 Кб -- 02.01.2013 Похожие документы
Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... ЛЕКЦИИ . МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... Лекция 1 (44) 6.10.2001 . ... профессор мехмата МГУ. ... На этом и на теореме Эйлера (обобщении малой теоремы Ферма) основана система шифрования RSA, о которой было рассказано на лекции. Познакомиться с этой системой можно, например, по статье 'Малая теорема Ферма' В. Сендерова и А. Спивака, опубликованной в первом, третьем и четвертом номерах 'Кванта' за 2000 год. ... Лекция 13 (56) 16.02.2002 . ... доцент кафедры газовой и волновой динамики мехмата МГУ; . ...
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . ... Deprecated : Non-static method JFactory::getConfig() should not be called statically, assuming $this from incompatible context in /wcmc/ms/ms/libraries/joomla/application/application.php on line 726 . ...