... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Abstracts . Abstract submission form . ... Abstract should not exceed 2 pages . ... automatic numbering (for equations, theorems, etc.), . ... Abstracts will be parsed automatically to compile the book of abstracts. ... TeX-file with the abstract should be submitted online through the abstract submission form . ...

Еще в разделе: (Показать все результаты (>15) - pont2008.cmc.msu.ru/ )

PLAN of the main events of the Russian Rectors' Union (RRU) for 2008 |Statute events of the RRU | ... Session of RRU's Council |February | ... higher and post-graduate professional education"", in | ... Session of RRU's Council |June | ... and innovative activities of higher education institutions | ... Session of RRU's Council |September | ... Main activities of RRU's Council of Higher Education institutions' Presidents |1. ... Sessions of Science, Technology and Education Council under |Constantly | ...

Еще в разделе: (Показать все результаты (>17) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/354.doc

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>10) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Fursova_Mil'ko_2006_en.pdf

Shows a complete history of a topic. ... When using PatternSkin enabling the HistoryPlugin changes the "History" link in the bottom action bar so it opens a page with a nice user interface where you can select the versions to compare. ... If RevCommentPlugin is installed and activated the "History" page will show the comments entered for each revision. ... Default layout: a simple list of topic revisions using the default format (see below) . ... Version: . ... Foswiki::Plugins::VERSION 1.024 . ...

Еще в разделе: (Показать все результаты (>1469) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) VarMETA < System < Foswiki
• (backlinks in System Web) VarMETA < System < Foswiki
• FileAttribute < System < Foswiki

Концептуальная неопределенность в расчетах растворимости в системах грунтовых вод: урок вычислений. ... С целью оценки выхода радионуклидов в грунтовые воды рассмотрено 4 компьютерных модели для расчета растворимости минералов, содержащих соединения актиноидов. Рассмотрены случаи расчета растворимости комплекса минералов, растворимости одного минерала, моделирование растворимости из поверхности пород, содержащих исследуемые соединения, и стохастическая модель растворимости. ...

Еще в разделе: (Показать все результаты (>5) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207100085

Evolutionary Ecology 1998, 12, 291±307 Evolutionarily optimal age schedule of repair : Computer modelling of energy partition between current and future survival and reproduction ANATOLY T. TERIOKHIN Department of Biology, Moscow State University, Moscow 119899, Russia Summary The aim of this study was to ... Let us now look at the inЇuence of the level of external mortality, associated with the parameter , on the optimal energy partition between reproduction and current survival. ...

Еще в разделе: (Показать все результаты (>34) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... COHO data . ... VOYAGER1 . ... OMNI data . OMNIData Set . LASRE data . ... Magnetopause Crossings Data . Magnetic Storms Data . ... VOYAGER1 data format description can be found here . Data are available from 1977-Sep-07 (Year 1977, Day 250) to 1989-Dec-31 (Year 1989, Day 365) . ... Year(YYYY): ,Day of the Year(DDD): ,Hour: . ... at the start of data interval . degrees, +/- 90 . ... degrees, 0-360 . BR in RTN coordinate system . nanoteslas . ... RTN-cordinate system) . ...

Еще в разделе: (Показать все результаты (>27) - dbserv.sinp.msu.ru/ )

• VOYAGER2 Online Data Set Selector
• ULYSSES Online Data Set Selector
• Magnetosphere

... Новости лаборатории . ... Romanova N.A., Fritz M.A., Tamm N.B., Troyanov S.I. Synthesis and X-ray structure of C 2 -C 84 (22)(CF 3 ) 6 , Mend. ... 2014) 24 , 78-79 DOI . ... Konarev D.V., Romanova N.A., Panin R.A., Goryunkov A.A., Troyanov S.I., Lyubovskaya R.N. Magnetic coupling and optical properties of the S 6 -dodecakis(trifluoromethyl)fullerene radical anions in the layered salt (PPN + )[C 60 (CF 3 ) 12 .- ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет ....

Еще в разделе: (Показать все результаты (>19) - thermolab.chem.msu.ru/ )

... Home Resources Publications Agricultural markets and global state of food.. ... Since the beginning of the 2000s the situation in the global agro-food market is characterized by the upward trend against the background of price volatility. The increase in consumption in developing countries, especially China and India, along with rising incomes and a shift in demand for more nutritious foods are some of the factors that determine the long-term increase in demand for agricultural commodities. ...

Еще в разделе: (Показать все результаты (>12) - ecfs.msu.ru/ )

... Описание вакансии: . Polymer . ... Experience in synthesis of functional and biodegradable/biocompatible polymers. ... Familiarity with analytical methods for determination of polymer purity including gas chromatography, atomic absorption spectroscopy (ICP-OES/MS) and liquid chromatography (HPLC). ... Experience with both solution and solid phase synthetic organic chemistry. ... Experience in protein binding methods is desirable (SPR-Biacore, calorimetry, ELISA, FACS). ... следующая вакансия . ...

Еще в разделе: (Показать все результаты (>39) - www.chemport.ru/ )

• "Product development manager russia" - вакансия в разделе "Работа для химиков"
• ЛИПИДНЫЕ ЗОНДЫ
• "Phd student in the institute of physical chemistry in warsaw" - вакансия в

... Родился 28 августа 1965 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1988 г. Специальность по образованию - физик. 1995 г. - защитил кандидатскую диссертацию. ... E-mail: larichev@optics.ru . ... Goncharov A.S., Iroshnikov N.G., Larichev A.V., Nikolaev I.P., The impact of speckle on the measurement of eye aberrations, 2014, Journal of Modern Optics, ? ... PDF . ... Goncharov A.S., Larichev A.V., Iroshnikov N.G., Ivanov V.Yu., ...

Еще в разделе: (Показать все результаты (>6) - medphys.phys.msu.ru/ )

... Practice of Business The course provides students with practical working experience in companies operating in various areas of business, including finance, communications, consultancies, natural resource management, high-tech and others. ... The course includes writing an industry-specific group report. ... Human resources management (international aspects) The course will provide a basic introduction to the organization of international human resources in business. ...

Еще в разделе: (Показать все результаты (>36) - www.mgubs.ru/ )

... Полная версия: Плазмапонг . Грация-МГУ::Форум > Общение > Общение . O'Rey . Aug 11 2007, 00:12 . Вот эта игруха будоражит умы современных ученых. http://flooders.ru/grace/PlasmaPongv13.zip . ... The requested URL /grace/PlasmaPong13.zip was not found on this server. Additionally, a 404 Not Found error was encountered while trying to use an ErrorDocument to handle the request. ... Это текстовая версия - только основной контент. ...

Еще в разделе: (Показать все результаты (>8) - grace.msu.ru/ )

... WN_LIST=/ opt / glite / yaim /etc/wn-list.conf USERS_CONF=/ opt / glite / yaim /etc/users.conf GROUPS_CONF=/ opt / glite / yaim /etc/groups.conf FUNCTIONS_DIR=/ opt / glite / yaim /functions OUTPUT_STORAGE=/tmp/jobOutput # Set this to your prefered and firewall allowed port range GLOBUS_TCP_PORT_RANGE= 20000,25000 PX_HOST=lcg14.sinp.msu.ru BDII_HOST=lcg-bdii. cern .ch MON_HOST=my-mon. cern .ch REG_HOST=my-reg ...

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>5) - hep.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

ERC Starting Grant 2010 Physical Sciences and Engineering HI Country DE FR ES CH FR ES CH IL FR ES FR DE FR IL FR DE FR NL FR UK DE IL FR CH PT NO FR XShape ... Hyrax Middens and Climate Change in Southern Africa during the last 50,000 years Games and Automata for Logic Extensions Panel PE6 PE6 PE9 PE2 PE3 PE5 PE1 PE5 PE1 PE8 PE5 PE7 PE3 PE6 PE6 PE1 PE6 PE6 PE9 PE5 PE3 PE7 ...

Еще в разделе: (Показать все результаты (>33) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/CSA_call_2009.pdf
• http://ideas.msu.ru/docs/AdG_call_2010.pdf
• http://ideas.msu.ru/docs/StG_call_2010.pdf

... VDNKh Medals: Bronze (1978, Tirskiy G.A.), Silver (1979, Tirskiy G.A.). The second M.V. Lomonosov Prize of Moscow State University for the work "The theoretical study of supersonic viscous nonequilibrium gas flow over bodies" (1985, Tirskiy G.A.). ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>7) - lab106.imec.msu.ru/ )

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )