Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...
... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...
ЖУРНАЛ МОСКОВСКОЙ ПАТРИАРХИИ . ... OFFICIAL INFORMATION Statement by the Patriarch of Moscow and All Russia and the Holy Synod on the creation in Russia of Catholic diocese and an 'ecclesiastical province' // 3 || ... Statement by Patriarch Alexy II of Moscow and All Russia and the Holy Synod of the Russian Orthodox Church on the Situation in the Middle East // 5 || ... Visits by His Holiness Patriarch Alexy II His Holiness the Patriarch Visits Moscow Churches on Holy Saturday by S. Ganzhin // 6 || ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...
... APPLICATION OF LASERS FOR INFORMATION STORAGE AND PROCESSING The Information Capacity of the L- System Photon Field Channel B. A. Grishanin and V. N. Zadkov Physics Faculty and International Laser Center, M.V. Lomonosov Moscow State University, Vorob'evy gory, Moscow, 119899 Russia e-mail: grishan@comsim1.phys.msu.su e-mail: zadkov@comsim1.phys.msu.su Received ... If the quantum channel is noisy, the output state is a ^ ^ linear transform of the input state: out = C in . ...
Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...
... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the proteinprotein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
... About choir . ... Conductor . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Askerov Mirza-Aga Saftarovich , born in 1959, honored cultural worker of the Russian Federation, honored worked of the All-Russian Musical Society, candidate of pedagogical sciences. ... Since 1990 has been working with the Academic Choir of Moscow State University on the recommendation of professor V.V. Baranov, the honored cultural worker of the Russian Federation. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...