Friday, December 7th, 2012 . ... No Comments ? Monday, December 3rd, 2012 . Добавлена страничка со списком публикаций сотрудников лаборатории за 2012 год. ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for December, 2012. ... Публикации за 2010 . Публикации за 2011 . Публикации за 2012 . ... January 2013 . December 2012 . ... January 2012 . ... January 2011 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>39) - geo.sai.msu.ru/ )

• December 2010 Лаборатория лазерной интерферометрии
• October 2012 Лаборатория лазерной интерферометрии
• October 2011 Лаборатория лазерной интерферометрии

www.vovr.ru 1992 14 Ї 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...

Еще в разделе: (Показать все результаты (>10) - www.umo.msu.ru/ )

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>5) - music.genebee.msu.su/ )

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>76) - engineering.phys.msu.ru/ )

• Introduction to Linux
• Science Festival 2013

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>36) - shamolin2.imec.msu.ru/ )

Igor P. Lokhtin . Participation in Conferences, Workshops and Schools in High Energy Physics . ... 18th Annual RDMS CMS Collaboration Conference . ... The 15th International Conference on Strangeness in Quark Matter . ... XXII International Workshop on High Energy Physics and Quantum Field Theory . ... International Conference-Session of the Section of Nuclear Physics of the Physical Sciences Division of Russian Academy of Sciences "Physics of Fundamental Interactions" . ... 4 March, 2011 (CERN) . ...

Еще в разделе: (Показать все результаты (>184) - lav01.sinp.msu.ru/ )

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ґ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ґ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК . ... PHYSICAL MODELS IN DNA SCIENCE . ... This process is useful for both physics and biology. ... As an example, we took the problem of interaction of nonlinear physics and mathematics with DNA science, and we discuss what new ideas, physical models, mathematical equations gave this interaction. ... New dynamical models . ... K/2) S n {[ 2R 2 0 [1- cos( Q n,1 - Q n-1,1 )] + u 2 n,1 + u 2 n-1,1 - 2 u n,1 u n-1,1 cos( Q n,1 - Q n-1,1 ) - . ... z n,2 - z n-1,2 | ...

Еще в разделе: (Показать все результаты (>17) - www.library.biophys.msu.ru/ )

• НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ

... For physics faculty . ... Number of lecturers and Professors: 28. ... Head of the Department : prof. D.R. Khokhlov. ... D.R. Khokhlov Doctor of Sciences (Physics and mathematics), Professor, Correspondent Member of the Russian Academy of Sciences. ... B.A.Strukov Doctor of Physics and Mathematics, Professor. ... Field of science activity: magnetic properties of solid state, rare earth magnets, itinerant magnetism, magnetic phase transitions . ... Head of the laboratory of Magnetic Semiconductors. ...

Еще в разделе: (Показать все результаты (>35) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>59) - nanofluidics.phys.msu.ru/ )

• Lobaskin
• Teaching
• Theses

. Home . Commission Members . Meetings . Newsletters . Forum . Electronic magazines . Commission publications . Forum archive . International Union of Soil Science . Commission on Paleopedology . International Union for Quaternary Research . Subcommission on Paleopedology . IUSS . << RERUM COGNOSCERE CAUSAS .

Еще в разделе: (Показать все результаты (>8) - www.paleopedology.msu.ru/ )

• Commission publications
• On-line publications

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>18) - imk.msu.ru/ )

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>19) - uranus.sai.msu.ru/ )

• Tatjana Khruzina
• Igor Antokhin
• Victor Oknyanskij

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>4) - vserv.sinp.msu.ru/ )

• RTM-CS

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>94) - www.mmonline.ru/ )

• Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Новости | Стипендия LSI Logic для аспирантов МГУ
• MMOnline | Аспирантура | Стипендия LSI Logic для аспирантов МГУ

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright © 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>5) - wwwlib.phys.msu.ru/ )