... История лаборатории КГЭ . Лаборатория КГЭ сегодня . ... Информация для студентов 1-3 курсов . ... This is Lotus Flower, is a free template from Free CSS Templates released under a Creative Commons Attribution 2.5 License . ... Phasellus tellus turpis, iaculis in, faucibus lobortis, posuere in, lorem. ... Vivamus varius justo sit amet leo. ... Nam cursus, orci sit amet porttitor iaculis, ipsum massa aliquet nulla, non elementum mi elit a mauris. ... Лаборатория катализа и газовой электрохимии | ...

Еще в разделе: (Показать все результаты (>2) - tragaty.chem.msu.ru/ )

... Написать комментарий . ... В наружном кольце преобладают яркие голубые звезды, а в центре находится шар из гораздо более красных звезд, которые, вероятно, значительно старше. ... Спиральная галактика с перемычкой NGC 1365 это действительно величественная островная вселенная, размер которой около 200 тысяч световых лет. ... Это скопление, известное также под именем Каппа Южного креста, насчитывает свыше ста звезд, а его возраст составляет около 10 миллионов лет. ...

Еще в разделе: (Показать все результаты (>232) - www.nature.web.ru/ )

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Department of the English Language Abstract Categorical Models of Quantum Mechanics By Alexander Zapryagaev, group 304 21 October 2014 The report deals with the axiomatic approach to the phenomena of quantum computation and algorithms. ... Finally, the logic behind quantum operations is discussed: it is revealed that the ideas of quantum algorithms have a strong connection to Jean-Yves Girard's linear logic. ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/dictionary.pdf
• http://www.eng.math.msu.su/download/Academic_English_part2.pdf

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI ? ? - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... Conference Venue . ... We are very glad to announce the Second Conference on Humic Innovative Technologies Natural and engineered nanoparticles in clean water and soil technologies ( HiT-2012 ) held under auspices of the CIS Chapter of IHSS. ... The conference organizers are the CIS IHSS Chapter , the Department of Chemistry of the Lomonosov Moscow State University (Russia) and NCP CBR Humus Sapiens . ...

Еще в разделе: (Показать все результаты (>155) - mgumus.chem.msu.ru/ )

• MGUMUS -- Vladimir A. Kholodov

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

... Information on your customer account . ... Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote D'Ivoire Croatia Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland...

Еще в разделе: (Показать все результаты (>33) - www.bukivedi.ru/ )

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.  ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.  . ... Сайт общеуниверситетских . подготовительных курсов  . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблем  и для их преподавания. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>6) - anazarenko.ffl.msu.ru/ )

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Excursions

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

196. Данные на картах в Интернет