... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>14) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part2.pdf

Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...

Еще в разделе: (Показать все результаты (>94) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2012/vecher29_2.pdf
• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>9) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/JourVND1104007KulaichevLO.pdf

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>18) - engineering.phys.msu.ru/ )

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>24) - shamolin2.imec.msu.ru/ )

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• Rikho Nymmik

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

• Conferences
• Neurophotonics
• Nonlinear optics of ionized mediums

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ґ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ґ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Symposia

... Anatoliy A.Polikarpov . ... Basing on the assumption of basic semantic micro- processes do minating in the history of any word meaning is possible to predict [Polikarpov, 1988; 1990; 1991; 1993; 1994; 1995] and to test ... Kapitan, 1994; Breiter, 1994; Breiter, Polikarpov, 1997; Savchuk, 1997] some most probable directions for the derivative micro- processes (e.g., change of some semasiological and word-formational parameters of a word) and for macro- evolution of a ...

Еще в разделе: (Показать все результаты (>60) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Dmitry V. Khmelev: List of Publications

Igor P. Lokhtin . Participation in Conferences, Workshops and Schools in High Energy Physics . ... 18th Annual RDMS CMS Collaboration Conference . ... The 15th International Conference on Strangeness in Quark Matter . ... XXII International Workshop on High Energy Physics and Quantum Field Theory . ... International Conference-Session of the Section of Nuclear Physics of the Physical Sciences Division of Russian Academy of Sciences "Physics of Fundamental Interactions" . ... 4 March, 2011 (CERN) . ...

Еще в разделе: (Показать все результаты (>49) - lav01.sinp.msu.ru/ )

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>17) - www.library.biophys.msu.ru/ )

• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

... For physics faculty . ... Number of lecturers and Professors: 28. ... Head of the Department : prof. D.R. Khokhlov. ... D.R. Khokhlov Doctor of Sciences (Physics and mathematics), Professor, Correspondent Member of the Russian Academy of Sciences. ... B.A.Strukov Doctor of Physics and Mathematics, Professor. ... Field of science activity: magnetic properties of solid state, rare earth magnets, itinerant magnetism, magnetic phase transitions . ... Head of the laboratory of Magnetic Semiconductors. ...

Еще в разделе: (Показать все результаты (>36) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Untitled

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright © 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>10) - wwwlib.phys.msu.ru/ )