... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>74) - engineering.phys.msu.ru/ )

• Science Festival 2013
• Introduction to Linux

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>36) - shamolin2.imec.msu.ru/ )

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )

• Rikho Nymmik

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Resources | ECFS
• Agricultural markets and global state of food suply | ECFS

... Consequently, weak fluctuations of the 1 growth rate concerning the M growth rate must necessarily generate strong fluctuations of the 2 growth rate. ... Statistics show that financial shocks occurred at positive values of ()(GDP). ... To test our hypothesis we consider correlation between TSec ґ an average annual growth rate of the market yield on U.S. Treasury securities at 1-year constant maturity ґ and ()-(GDP) over 1960-2009. ... Correlation between ()-(GDP) and the yields spread became...

Еще в разделе: (Показать все результаты (>34) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf
• http://www.mse-msu.ru/RAS_Resolution.pdf

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on ?English for Students of Mathematics and Mechanics? by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Sample_theses.pdf
• http://www.eng.math.msu.su/download/Midterm_test.pdf

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>28) - silab.sinp.msu.ru/ )

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>61) - dfgm.math.msu.su/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>38) - imk.msu.ru/ )

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>54) - acoustics.phys.msu.ru/ )

... Announcement of the Availability of the LSI Logic International Services Scholarship to Post-Graduate Students of Moscow State University and Moscow Institute of Physics and Technology . ... Interested applicants should submit the following documents not later than September 26, 2003 : . ... LSI Logic International Services is wholly own subsidiary of LSI Logic Corporation, Milpitas, California. ... LSI is headquartered at 1621 Barber Lane, Milpitas, CA 95035. ... LSI Logic . ...

Еще в разделе: (Показать все результаты (>269) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD positions in logic and AI, Vancouver
• MMOnline | Форумы | Преподаватели | А.Т. Фоменко
• MMOnline | Аспирантура | Стипендия LSI Logic для аспирантов МГУ

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Symposia

... Chemically Decoupled Nuclei in Five Lenticular Galaxies from SAURON Data O. K. Sil'chenko* Sternberg Astronomical Institute, Universitetski i pr. ... We have now analyzed and published the SAURON data for five galaxies, including the above NGC 3384 and NGC 3623, in which the chemically decoupled nuclei are rather extended (several hundred parsecs) circumnuclear stellar disks. ... 1996 SAURON, Oct. ... In NGC 7280, we found an inner polar ring previously using MPFS data (Afanasiev and Sil'chenko 2000...

Еще в разделе: (Показать все результаты (>51) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/ar1101.pdf
• Olga Silchenko

J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog
• SAI OCL Catalog Structure
• SAI OCL Catalog Publications

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>19) - uranus.sai.msu.ru/ )

• Igor Antokhin
• Nikolay Bochkarev
• Elena Seifina. Publications