... B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov, S.M.Chudinov, O.B.Yatsenko. ... Fiz. (in Russian), 31 304-307 (1980). B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov. ... B.A.Akimov, N.B.Brandt, A.A.Zhukov, L.I.Ryabova, D.R.Khokhlov. ... Poluprovodn. (in Russian), 17 87-92 (1983). ... B.A.Akimov, A.M.Gas'kov, L.I.Ryabova, D.R.Khokhlov. ... D.E.Dolzhenko, I.I.Ivanchik, A.V.Nikorich, D.R.Khokhlov, S.N.Chesnokov. ... B.A.Akimov, A.V.Albul, I.I.Ivanchik, L.I.Ryabova, E.I.Slyn'ko, D.R.Khokhlov. ...

Еще в разделе: (Показать все результаты (>35) - ferro.phys.msu.ru/ )

• Physics Faculty of Moscow State University.
• Physics Department of Moscow State University

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>6) - uneex.cs.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>20) - uranus.sai.msu.ru/ )

• Elena Seifina. Publications
• Igor Antokhin
• Irina Glushneva

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>122) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>10) - wwwlib.phys.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Kucheriavenko Ekaterina | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...

Еще в разделе: (Показать все результаты (>25) - www.sai.msu.ru/ )

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>17) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/JourVND1104007KulaichevLO.pdf

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/files/publications.pdf

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>5) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>9) - compmech.math.msu.su/ )

New Series of Editions from the History Faculty of MSU . ... Historical Research . ... Through the publication of programs of general courses, the History Faculty of MSU opens a series of works designed to reflect the results of the most important research currently being conducted within the faculty, as well as to represent the experience gained through the teaching of historical disciplines. ... The first series of works published by the History Faculty of MSU is "Historical Sources". ...

Еще в разделе: (Показать все результаты (>372) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>2) - dionis.sai.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master program "Information Security and Cryptography" | Магистерское и

The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...

Еще в разделе: (Показать все результаты (>65) - old.philol.msu.ru/ )

• MSU-LGCLL:: Anatoliy A.Polikarpov - Semasiological and Word-formational

... Написать комментарий . ... Эксперты Министерства обороны США предлагают отложить на один год сроки запусков второго, третьего и четвертого спутников системы инфракрасного наблюдения за земной поверхностью космического базирования (Space-Based Infrared System High, SBIRS-High), чтобы "минимизировать затраты на создание и развертывание системы". ... Запуск первого из них пока планируется на конец 2004 года или начало 2005 года. ...

Еще в разделе: (Показать все результаты (>793) - www.nature.web.ru/ )

• L-Глутаматоксидаза стрептомицетов: применение в клинической и фундаментальной
• Научная Сеть - Scientific Network
• Возвышенности и впадины Земли

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>36) - acoustics.phys.msu.ru/ )

• A.V.Shanin

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf