Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...

Еще в разделе: (Показать все результаты (>90) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2015/utro_stend_28.pdf

... Kinematics and stellar population properties in the center of nearby Sbc galaxy NGC 5055 are studied with the Multi­Pupil Spectrograph of the 6 m telescope of the Special Astrophysical Observatory of Russian Academy of Sciences (SAO RAS). ... We have found a resolved chemically distinct core in NGC 5055, with the magnesium­enhanced region shifted by 2. ## 5 (100 pc) to the south­west from a photometric center, toward a kinematically identified circumnuclear stellar disk. ... 22 ± 6 Ionized gas 1. ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/ar1101.pdf
• http://sn.sai.msu.ru/~sil/preprints/counter.pdf

www.vovr.ru 1992 14 · 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...

Еще в разделе: (Показать все результаты (>11) - www.umo.msu.ru/ )

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>43) - engineering.phys.msu.ru/ )

• Introduction to Linux

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>25) - shamolin2.imec.msu.ru/ )

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on «English for Students of Mathematics and Mechanics» by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>16) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Midterm_test.pdf

... B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov, S.M.Chudinov, O.B.Yatsenko. ... Fiz. (in Russian), 31 304-307 (1980). B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov. ... B.A.Akimov, N.B.Brandt, A.A.Zhukov, L.I.Ryabova, D.R.Khokhlov. ... Poluprovodn. (in Russian), 17 87-92 (1983). ... B.A.Akimov, A.M.Gas'kov, L.I.Ryabova, D.R.Khokhlov. ... D.E.Dolzhenko, I.I.Ivanchik, A.V.Nikorich, D.R.Khokhlov, S.N.Chesnokov. ... B.A.Akimov, A.V.Albul, I.I.Ivanchik, L.I.Ryabova, E.I.Slyn'ko, D.R.Khokhlov. ...

Еще в разделе: (Показать все результаты (>35) - ferro.phys.msu.ru/ )

• Physics Faculty of Moscow State University.
• Physics Department of Moscow State University

TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>17) - www.library.biophys.msu.ru/ )

• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

... Moscow State University Russian Language Centre . ... The University of Nebraska-Lincoln Russian Club and the Department of Modern Languages and Literatures hosted Russian Night, the last event of Russian Week, at the UNL Culture Center. (more.. ... The international scientific conference " The Humanity and the environment " was held on 26-28 October, at the Moscow М.В. Lomonosov State University.The Conference was organized in partnership with State university of New York (SUNY). (more.. ...

Еще в разделе: (Показать все результаты (>12) - www.rlcentre.com/ )

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>37) - acoustics.phys.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... MSU will contribute to a new youth project ?Arctic Expedition? ... According to the website of the MSU Faculty of Biology , MSU will hold International Universiade in Biology from November 21 to November 23, 2014. ... This year the International Universiade in Biology is held for the fourth time. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>40) - talant.msu.ru/ )

• Competition provided by The Central Election Commission of the Russian
• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional

... Master . Master net Homepage . ... MASTER . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... Russian Robotic Net MASTER of Lomonosov Moscow State University discovered the Most Powerfull Object in the Universe . ... Using the 40-cm (16-inch) f/2.5 reflectors equipped with 16-Mpix CCD cameras they have found the brightening of the poorly studied flat spectrum radio quasar CGRaBS J0809+5341 = FIRST J080941.7+534125 with the known redshift z=2.133. ...

Еще в разделе: (Показать все результаты (>218) - master.sai.msu.ru/ )

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>6) - uneex.cs.msu.su/ )

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>103) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida
• Стипендия LSI Logic для аспирантов МГУ
• До 1 ноября Springer предоставляет бесплатный доступ к более чем 150

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>5) - wwwlib.phys.msu.ru/ )