... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>10) - engineering.phys.msu.ru/ )

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...

Еще в разделе: (Показать все результаты (>106) - hbar.phys.msu.ru/ )

• Robert R. Newton, The Secular Acceleration of the Earth's Spin
• Historical Eclipses
• The jump of the second derivative of the moon's elongation

... B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov, S.M.Chudinov, O.B.Yatsenko. ... Fiz. (in Russian), 31 304-307 (1980). B.A.Akimov, N.B.Brandt, L.I.Ryabova, D.R.Khokhlov. ... B.A.Akimov, N.B.Brandt, A.A.Zhukov, L.I.Ryabova, D.R.Khokhlov. ... Poluprovodn. (in Russian), 17 87-92 (1983). ... B.A.Akimov, A.M.Gas'kov, L.I.Ryabova, D.R.Khokhlov. ... D.E.Dolzhenko, I.I.Ivanchik, A.V.Nikorich, D.R.Khokhlov, S.N.Chesnokov. ... B.A.Akimov, A.V.Albul, I.I.Ivanchik, L.I.Ryabova, E.I.Slyn'ko, D.R.Khokhlov. ...

Еще в разделе: (Показать все результаты (>35) - ferro.phys.msu.ru/ )

• Physics Faculty of Moscow State University.
• Physics Department of Moscow State University

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>18) - www.library.biophys.msu.ru/ )

• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>7) - iconolat13.phys.msu.ru/ )

• Symposia
• Program topics

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>7) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>6) - uneex.cs.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>20) - uranus.sai.msu.ru/ )

• Elena Seifina. Publications
• Igor Antokhin
• Irina Glushneva

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>126) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright © 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>5) - wwwlib.phys.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Kucheriavenko Ekaterina | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI ? ? - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/files/publications.pdf

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>5) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html

... Structural Analysis of Disk Galaxies of the NGC 524 Group M. A. Il'ina and O. K. Sil'chenko * Sternberg Astronomical Institute, Lomonosov Moscow State University, Moscow, Russia Received February 24, 2012; in final form, March 2, 2012 Abstract--Members of the NGC 524 group of galaxies are studied using data obtained on the 6m telescope of the Special Astrophysical Observatory of the Russian Academy of Sciences, with the SCORPIO reducer in an imaging mode. ... NGC 502. ... NGC 524. ... Rev. Astron. ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/uvrings.pdf
• http://sn.sai.msu.ru/~sil/preprints/al75.pdf
• http://sn.sai.msu.ru/~sil/preprints/expsauron.pdf

New Series of Editions from the History Faculty of MSU . ... Historical Research . ... Through the publication of programs of general courses, the History Faculty of MSU opens a series of works designed to reflect the results of the most important research currently being conducted within the faculty, as well as to represent the experience gained through the teaching of historical disciplines. ... The first series of works published by the History Faculty of MSU is "Historical Sources". ...

Еще в разделе: (Показать все результаты (>366) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences

ARM . 12: Ї ARM 2 ARM Powered Products 3 ARM Ї 4 Ї ARM 32- . ARM : ґ Byte - 8 bits ґ Halfword - 16 bits ( ) ґ Word - 32 bits ( ) Ї ARM ґ 32-bit ARM Instruction Set ґ 16-bit Thumb Instruction Set 5 Ї ARM : ґ User : , ґ FIQ : , high priority (fast) ґ IRQ : , low priority (normal) ґ Supervisor : Software Interrupt instruction ґ Abort : ґ Undef : ґ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

FACULTAD DE CIENCIAS POLITICAS DE LA UNIVERSIDAD ESTATAL DE MOSCз M. V. LOMONсSOV Encargado del cargo de Decano - El doctor de ciencias historicas, Profesor (A. Yu. ... Al dia de hoy en la Facultad de Ciencias Politicas, funcionan cinco catedras: . ... La Facultad de Ciencias Politicas presta la posibilidad de realizar estudios especializados en los siguientes programas de estudio por contracto, los cuales han sido diseЯados con base a las necesidades del mercado laboral. ...

Еще в разделе: (Показать все результаты (>11) - polit.msu.ru/ )

• http://polit.msu.ru/pub/fl-doc/French.doc
• Профессор Елена Борисовна Шестопал приняла участие в конференции Кембриджского