... We live in the epoch of modern informational, scientific and intellectual technologies. Modern person, especially young one, cannot imagine life without computers, cellular phones and high-speed Internet. ... History has given a lesson - having splendid science, excellent education and highly organized society, having colossal resources, being a great power, we could not cope with the task - to build a prospering and just society. ... It demonstrates the colossal possibilities of modern science. ...

Еще в разделе: (Показать все результаты (>64) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/395.doc
• http://www.rsr-online.ru/doc/norm/111.doc
• http://www.rsr-online.ru/doc/2011_09_26/4.pdf

... Rete 1. Forgy, Charles L. "Rete: A Fast Algorithm for the Many Pattern/Many Object Pattern Matching Problem." Artificial Intelligence, Vol. 19, ? ... Proceedings of the Fifth National Conference on Artificial Intelligence, AAAI, Philadelphia, 1986, pp. ... Scales, D. "Efficient matching algorithms for the SOAR/OPS5 production system." ... Proceedings of the Sixth IEEE Conference on Artificial Intelligence Applications, 1990, pp. ... TREAT: a better match algorithm for AI production system." ...

Еще в разделе: (Показать все результаты (>60) - sp.cs.msu.ru/ )

• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• Темы докладов, курсовых и дипломных работ. 1998-1999 учебный год

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>22) - imk.msu.ru/ )

... Наука >> Вычислительная математика >> Теория и алгоритмы | ... 0 ] (обратно к тексту) Полная версия настоящего эссе: www.mi.ras.ru/~razborov/computerra.ps . 1 ] (обратно к тексту) S. Smale, "Mathematical problems for the next century", Mathematical Intelligencer , 1998, vol. 20, number 2, pages 7-15. [ 2 ] (обратно к тексту) А. Саломаа, "Криптография с открытым ключом", М.: "Мир", 1996. ... 6] А. Разборов, " P=NP , или Проблема перебора: взгляд из 90-х", www.mi.ras.ru/~razborov/phasis.ps . ...

Еще в разделе: (Показать все результаты (>1071) - www.nature.web.ru/ )

• Научная Сеть >> Приз в 1 миллион долларов за решение каждой из семи
• Джордж Малати "Математическое образование в странах третьего мира -- надежда
• Марс: детальная разведка

RUSSIAN PEREPLET . Culture, Science, and Education Portal . Science Space Culture General Discussion Scientific Discussion Seminars . News: The best of Russian Science and Technology . ... MASTER Team Science Release: Discovery of the Black Hole Ergosphere? ... The International Conference "The International Conference" . ... MASTER is the first russian asteroid factory . ... New Russian "Volga" . ... MASTER - is the first russian robotic telescope for observations Gamma-Ray Bursts . ...

Еще в разделе: (Показать все результаты (>166) - www.pereplet.ru/ )

• Super Ratio

... Новости . ... Лаборатории . ... Оценка и экспертиза почв . ... создать лабораторию экологического почвоведения в составе кафедры географии почв. ... Наибольший интерес вызвало последнее занятие, интегрированное в Парад почв, организованный совместно с факультетом почвоведения МГУ. ... С глубоким прискорбием сообщаем о скоропостижной кончине заведующего лабораторией биоразнообразия почв Института экологического почвоведения МГУљчлен-корреспондента РАН, профессора Чернова Ивана Юрьевича. ...

Еще в разделе: (Показать все результаты (>12) - soilinst.msu.ru/ )

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>19) - site2010.sai.msu.ru/ )

... help . find changesets by author, revision, files, or words in the commit message hg bisect [-gbsr] [-U] [-c CMD] [REV] subdivision search of changesets This command helps to find changesets which introduce problems. To use, mark the earliest changeset you know exhibits the problem as bad, then mark the latest changeset which is free from the problem as good. ... As a shortcut, you can also use the revision argument to mark a revision as good or bad without checking it out first. ...

Еще в разделе: (Показать все результаты (>381) - kodomo.cmm.msu.ru/ )

• Department of animal cell biochemistry - Staff and contacts
• TracModWSGI тАУ Tanchiki
• Department of animal cell biochemistry - Research and Projects

... help . find changesets by author, revision, files, or words in the commit message hg bisect [-gbsr] [-U] [-c CMD] [REV] subdivision search of changesets This command helps to find changesets which introduce problems. To use, mark the earliest changeset you know exhibits the problem as bad, then mark the latest changeset which is free from the problem as good. ... As a shortcut, you can also use the revision argument to mark a revision as good or bad without checking it out first. ...

Еще в разделе: (Показать все результаты (>1211) - kodomo.fbb.msu.ru/ )

• allpy: log
• allpy: 9adbec7c3366 sandbox/gl.py
• allpy: 9adbec7c3366 test/test.py

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>9) - www.niiss.ru/ )

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>34) - lomonosov.sinp.msu.ru/ )

• BDRG | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>10) - discours.philol.msu.ru/ )

... for Food Security . Home Events Online Consultation on Network and Partnerships.. ... This discussion will serve as a preparatory stage for the upcoming International Conference on International Conference on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership to be held in Bishkek, February 29-March 2, 2016. ... Topic 1: Building the Eurasian Food Security Network . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...

Еще в разделе: (Показать все результаты (>32) - ecfs.msu.ru/ )

• Economic Department | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• The Department of land resources | ECFS

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Main results of different objects studying using scanning probe microscopy methods are 3-dimensional images of these objects usually. ... It gives significantly more convenient image processing, but photographic quality, common for electronic microscopy methods was lost. Information obtained with scanning probe microscope is represented in a computer as numbers in 2 dimensional matrix. ... Thus, every matrix value is represented by point of some colour on a rectangular image. ... Averaging data . ...

Еще в разделе: (Показать все результаты (>76) - www.spm.genebee.msu.ru/ )

• FemtoScan Online FAQs
• C U R R I C U L U M V I T A E
• Olga's Main Page

Evolution of the double neutron star merging rate and the cosmological origin of Gamma-ray burst sources " , Astroph.J., 1995, v.454, 593-596 (Lipunov, V.M. Postnov, K.A. and Prokhorov M.E.) . Evolution of SupernovaЃExplosion Rates in theЃ Universe (Jorgensen H., Lipunov.M., Panchenko I.E., Postnov K.A., Prokhorov M.E.) ApJ, 1997, v.486,p.110 . ... Formation of a Gravitationally Bound Object after Binary Neutron Star Merging and GRB phenomena " (G.V.Lipunova, V.M.Lipunov). ...

Еще в разделе: (Показать все результаты (>214) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...

Еще в разделе: (Показать все результаты (>10) - www.bukivedi.ru/ )

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>6) - ccoe.msu.ru/ )