Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>16) - swx.sinp.msu.ru/ )

... Our faculties perform research within the frame of more than 80 collaborative agreements with the universities and scientific centers worldwide, actively participate in various international projects under umbrella of the Russian and international funding agencies. ... F irst, we are interested in collaboration with those research centers and universities worldwide who offer research opportunities complimentary to ours. ... Germany . ... Institute or Nuclear Physics, National Nuclear Centre . ...

Еще в разделе: (Показать все результаты (>39) - foroff.phys.msu.ru/ )

• Глубокоуважаемые коллеги
• Postdoctoral training of foreign scientists at Physical Department

. ASA's collection of pictures useful for WWW-pages creation. ARROWS: 1-91 . BALLS: 1-145 . BUTTONS: 1-156 . ICONS: 1-263 . LINES: 1-174 . PATTERNS: 1-60 . VGIFS: 1-23 . You are since 9 July 1999 at this page. Go to Lab's HomePage . Go to ASA's HomePage .

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

• People on #C4ACTbE right now

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>3) - cmp.phys.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... This Python module parses Gaussian cube files, produced by quite a few QM software packages, and makes volume data available as numpy array as well as some associated properties. ... Нет комментариев " Gaussian Cube files loader " . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>16) - erg.biophys.msu.ru/ )

• Lipid membrane MD modeling with GROMACS ERG Research Group: Лаборатория
• membrane ERG Research Group: Лаборатория теоретической биофизики

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>13) - photonicslab.phys.msu.ru/ )

... November 9, 1999 . Spiral Galaxies in Collision . ... the Hubble Heritage Team ( AURA / STScI / NASA ) . ... Until then, spiral galaxies NGC 2207 and IC 2163 will slowly pull each other apart, creating tides of matter, sheets of shocked gas , lanes of dark dust , bursts of star formation , and streams of cast-away stars . Astronomers predict that NGC 2207, the larger galaxy on the left, will eventually incorporate IC 2163, the smaller galaxy on the right. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>19) - www.arcetri.astro.it/ )

• APOD: April 9, 1999 - WR 104: Pinwheel Star

... Регистрация . ... Форумы > Первокурсникам > Регистрация . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>329) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура
• MMOnline | Форумы | Абитуриентам
• MMOnline | Форумы | Преподаватели

... Написать комментарий . ... В наружном кольце преобладают яркие голубые звезды, а в центре находится шар из гораздо более красных звезд, которые, вероятно, значительно старше. ... Спиральная галактика с перемычкой NGC 1365 это действительно величественная островная вселенная, размер которой около 200 тысяч световых лет. ... Это скопление, известное также под именем Каппа Южного креста, насчитывает свыше ста звезд, а его возраст составляет около 10 миллионов лет. ...

Еще в разделе: (Показать все результаты (>1031) - www.nature.web.ru/ )

• III International conference on cryogenic soils

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql

... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow University Press, 1994. ... W. Stevens. тАУ History of American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...

Еще в разделе: (Показать все результаты (>9) - discours.philol.msu.ru/ )

• Summer School 2016
• Events

News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>34) - www.anthropos.msu.ru/ )

• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Information on your customer account . ... Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote D'Ivoire Croatia Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland...

Еще в разделе: (Показать все результаты (>27) - www.bukivedi.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>36) - cellmotility.genebee.msu.ru/ )

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>81) - music.genebee.msu.ru/ )

. Rolling Simplexes and their Commensurability. (Axiom and Criterion of Incompressibility, Momentum Lemma) / Razmyslov Yu.P. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2011. ? 5. P. 55-58 [Moscow Univ. Math. Bulletin. Vol. 66, N 5, 2011.]. The total geometrical theory of field is recreated. Key words : projective plane, affine chart, rolling, incompressibility, desargues condition, field. ? 5/2011 . Toggle formulas format . (LaTeX / SVG)

Еще в разделе: (Показать все результаты (>22) - vestnik.math.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...

Еще в разделе: (Показать все результаты (>85) - vertebrata.bio.msu.ru/ )

• Leaders of the Department
• Выступления студентов и аспирантов на конференциях