... class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 7 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p2 # , p1 def proximity(self, p1, p2): # in bool # self.edges[p1] p2 return p2 in self.edges[p1] 3.1.1.2. . class applied_topology(ost.Topology.Abstract): #, # p1 self.edges[p1] # p2 p1 self.edges = { p1: [p1_1,...,p1_k1] p2: [p2_1,...,p2_k2] ... pM: [pM_1,...,p1_kM] } # p # , p def neighborhood(self, p): return self.edges[p] . ...

Еще в разделе: (Показать все результаты (>7) - compmech.math.msu.su/ )

• http://compmech.math.msu.su/publ/publ_mensh.pdf

... MAX, MAX], MAX = 3'812'798'742'493. . ... MEMCAP - (read only) CSP - Control Stack Pointer - CSPL - CSP Low ­ CSP - CSP High ­ DSP - Data Stack Pointer - DSPL - DSP Low ­ DSP - DSP High ­ EXC - Exception ­ (0 ­ ) PC - Program Counter ­ STATUS - . ... EXC==-3) && (STATUS[IE]==1))) { pushcs(STATUS); // STATUS STATUS[IE]=0; // pushcs(PC); // PC PC = m(IVBASE + EXC); // EXC = 0; } else // { if (ICL == 1) // IC locked, IC ICL=0; else // { IC = m(PC); PC = PC+3; } } // IC PC execute; . ... STATUS. ...

Еще в разделе: (Показать все результаты (>2) - ternarycomp.cmc.msu.ru/ )

... PE8_10 Production technology, process engineering PE8_11 Product design, ergonomics, man-machine interfaces PE8_12 Lightweight construction, textile technology PE8_13 Industrial bioengineering PE8_14 Industrial biofuel production PE9 Universe sciences : astro- physics / chemistry / biology ; solar system; stellar, galactic and extragalactic astronomy, planetary systems , cosmology; space science , instrumentation PE9_1 Solar and interplanetary ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Results_PE.pdf

... American), headings and the style of referencing. ... The opening page of a contribution in the NATO book series should always be a right hand page and should consist of: the title in capital letters, bold font, flush left, on the fourth text line; followed by the subtitle (if present) in italics, flush left, with one line of white above. ... First-order Heading This heading is in bold, upper and lowercase letters, numbered in arabic figures, and has two lines of space above and one line below. ...

Еще в разделе: (Показать все результаты (>100) - mgumus.chem.msu.ru/ )

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2014.pdf

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>32) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP2010Dolgopolov.pdf
• http://qfthep.sinp.msu.ru/talks2013/QFTHEP-Golovnev.pdf
• http://qfthep.sinp.msu.ru/talks2013/QFTHEP-KolevatovR.pdf

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>20) - rswater.phys.msu.ru/ )

• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

... Seminar archive . ... Seminar archive 2014 17 October . ... Giovannelli Franco ( INAF ? ... Giovannelli Franco . Professor Dr Franco Giovannelli . ... In this seminar I present a very wide panorama about the most important steps that significantly improved our knowledge on the physics of our Universe.* ... Franco Giovannelli & Lola Sabau-Graziati: 2004, Kluwer Academic Publishers, and . Franco Giovannelli & Lola Sabau-Graziati: 2004, Space Sci. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>7) - master.sai.msu.ru/ )

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... T he goal of this Master Degree program is to educate specialists with the knowledge of the newest technologies of geological study, modeling and development of deposits, advanced scientific methods of seismic and geophysical exploration, geophysical well-logging, production enhancement, etc. ...

Еще в разделе: (Показать все результаты (>5) - www.hsib.msu.ru/ )

• Master Degree in Chemistry | Высшая школа инновационного бизнеса МГУ

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...

Еще в разделе: (Показать все результаты (>65) - ffl.msu.ru/ )

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>21) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2014/downloads/Program.pdf

О кафедре . ... Главная -> Учебный процесс -> Лекционные курсы -> Пакеты прикладных программ -> Программа курса . Лекционные курсы . ... Языки программирования и библиотеки подпрограмм для численных расчетов ( библиотека численного анализа НИВЦ МГУ, NAG Library, Netlib ). ... Системы компьютерной алгебры и универсальные системы численных расчетов ( Maple, Mathematica, Matlab, Mathcad ). ... Учебный курс. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...

Еще в разделе: (Показать все результаты (>8) - oc.cs.msu.ru/ )

... Email . ... Department of Chemistry, Lomonosov Moscow State University, 1992 . ... D. (Organic Chemistry), 2002 . ... genie@qsar.chem.msu.ru . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... 7 (495) 939-3557 . ... medicinal chemistry, chemoinformatics, computer-aided drug design, QSAR, bioactivity, molecular modeling, virtual screening . ... Eugene_Radchenko . ... Radchenko, Eugene V. Home . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>13) - qsar.chem.msu.ru/ )

• Karpov, Pavel V. - Laboratory of Medicinal Chemistry

... 26-Sep-2011 12:35 . ... 62K . ... 53K . ... 77K . ... 57K . ... 79K . ...

Еще в разделе: (Показать все результаты (>78) - uneex.mithril.cs.msu.su/ )

• HelpOnSearching - UNИX
• LecturesCMC - UNИX
• Events - UNИX

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~dimawolf/RTES/Lection03.pdf

Кафедра биофизики . ... Kovalenko I. B. , Abaturova A. M. , Diakonova A. N. , Ustinin D. M. , Grachev E. A. , Rubin A. B. New direct dynamic models of protein interactions coupled to photosynthetic electron transport reactions // Biophys. ... Коваленко И. Б. , Абатурова А. М. , Громов П. А. , Устинин Д. М. , Грачев Н. Е. , Ризниченко Г. Ю. , Рубин А. Б. Компьютерное моделирование образования комплекса между пластоцианином и цитохромом f в люмене тилакоида Биофизика, 2008, 53 (2) 261-270 . ...

Еще в разделе: (Показать все результаты (>4) - www.biophys.msu.ru/ )

• Сектор информатики и биофизики сложных систем
• Technical Specifications

... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...

Еще в разделе: (Показать все результаты (>274) - www.geogr.msu.ru/ )

• Список литературы

... 2002. ... 110 MT2 MT8, 9 MT8 MT2 MT8 111 373 374 MT8 MT2 375 376 MT8 MT8 MT8 MT7 377 3 MT2 378 379 MT8 MT1 MT8 MT7 380 MT5 MT2 381 382 MT2, 5, 6, 7 MT2 383 . ... MT1, 8 112 MT7 MT8 MT4 MT8 MT2 MT7 MT8 MT2, 5, 6, 7 MT2 MT1 8 MT2 MT8 MT2, 8 MT8 MT8 113 MT8 MT8 MT7, 8 MT8 MT4 MT8 MT2 MT1, 2, 4, 7, 8, 9 MT8 MT1-9 395 Gunter C. Semantics of Programming Languages. ... 116 MT9 MT8 117 « » MT8 MT3 MT5, 9 MT8 MT2 MT7 P1, IT8 P1 P1, IT8 IT1, IT8 P1 MT2, 8 P7, IT1 P3, IT1 445 Tucker A. Applied Combinatorics. ...

Еще в разделе: (Показать все результаты (>4) - math.chem.msu.ru/ )

• BK_Assignments - Новый элемент
• BK_Assignments -