... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Course "Computer Physics" for 1st and 2nd year students of Physics . ... The audience is 1st and 2nd year students of Physics. ... It consists of a short lecture course, seminars, and a large number of computer labs. ... 1985-1994 : Lectured a specialized course on "Computer Physics"for the 3rd year students of Physics, Department of Physics, and attendees of the continuing education department, International Laser Center of Moscow State University. ... 2016 Quantum Information Laboratory. ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...
... Contact information: Chemistry Department, Moscow State University , Leninskie gory, Moscow 119991, Russia . ... 1988 : PhD in Chemistry (heterocyclic synthesis) . ... Host Prof. J. Liebscher) . ... Host Prof. A. Haas) . ... 1999-now: Lecturer at Moscow High Chemistry College with Heterocyclic Chemistry semester course . 1988-1998 : Lecturer at Moscow University with Heterocyclic Chemistry semester course . ... 3 rd International A.N.Kost meeting on heterocyclic chemistry, Moscow , Russia . ...
... Актуальная информация . ... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ...
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
... Общая информация . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... Высшая школа инновационного бизнеса (факультет) МГУ имени М.В. Ломоносова (Корпоративный университет) создана в 2006 г. Объединяя ресурсы разных факультетов МГУ, Высшая школа видит своей задачей оперативную адаптацию классических университетских программ обучения к меняющимся запросам производства и развитие инновационных механизмов, обеспечивающих передачу на производство новых технологий ? ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . Prof. Dr. Olga I. Vinogradova . Moscow State University . ... Research . ... Professor, Director of Laboratory . ... Type of research: . ... She then joined the group of Prof. Boris V. Derjaguin at the Laboratory of Physical Chemistry of Modified Surfaces, part of the A.N.Frumkin Institute of Physical Chemistry and Electrochemistry (Russian Academy of Sciences) as a research fellow. ...
... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
... The Science Operation Department is composed of Astronomers, Telescope Instruments Operators(TIOs) and Data Handling Administrators(DHAs). ... Astronomers have proposed several methods to quantitatively measure the amount of turbulence above the telescope, which the most common ones is Differential Image Motion Monitor (DIMM). In optical testing, the Hartmann test is the common method to test the quality of optical components. ... Hartmann mask consists of 48 lenses. ...
RIDGE AND TREE FEATURE DETECTION ON IMAGES A. Levashov 2, D. Yurin3 2, 3 1 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia 2 alexeylevashov89@gmail.com , 3yurin@cs.msu.ru In this article a new ridge detector with improved non-maxima suppression procedure in scale-space is proposed. ... The algorithm is tested on synthetic, landscape and medical images. ...
[
Текст
]
Ссылки http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf -- 603.0 Кб -- 18.11.2013 Похожие документы
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы