О лаборатории . Публикации . ... Лаборатория теоретической биофизики . ... Биофизика, 57(2) 197?204 (2012) . ... П. М. Красильников , П. П. Нокс, А. Б. Рубин. О влиянии локального молекулярного окружения на величину редокс-потенциала кофакторов электронного переноса в бактериальных фотосинтетических реакционных центрах, Биофизика 56(2) 248-254 (2011) . ... Биофизика 56(2) 255-264 (2011) . ... А.М. Нестеренко , П.М. Красильников , Ю.А. Ермаков. ... 2008 ERG Research Group . ...
CRIMEAN FIELD GEOLOGICAL CAMP, FIRST YEAR (1st CRIMEAN) . First Crimean Field Camp is organized for the MSU Geological Faculty first year students. ... Professors and researchers from Dynamic Geology Department of Geological Faculty and Russian Academy of Science Institute of Geology are leadind the students. ... SHORT HISTORY OF THE 1st CRIMEAN . ... The main goal of the field camp is to show students how geological processes work now and what we can learn about them in the past. ...
... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...
... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... in Russia by the Russian Space Agency (ROSCOSMOS) under the name UV atmosphere, included in the Long Term Program for Scientific Experiments and Applied Research planned for the Russian segment on ISS (PI B.A. Khrenov). ...
... About CIE MSU . ... Vestnik CIE (in Russian) . ... About Moscow University . ... The CIE provides tuition in Russian in accordance with the course of study and study programmes depending on the chosen subjects, goals, and forms of study as stated in the student s contract. ... Also the students can use the library, audio collections, video- and computer classes of the Center. ... Students are expected to attend classes, complete academic assignments, observe the University rules and regulations. ...
... Поиск по МГУ | ... Московский государственный университет имени М.В. Ломоносова получил доступ к базам данных ведущих мировых издательств . По результатам конкурса в рамках федеральной целевой программы 'Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2014-2020 годы' Московский государственный университет имени М.В. Ломоносова получил право доступа к следующим базам данных ведущих мировых издательств: . ... МГУ имени М.В. Ломоносова . ...
Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Полная версия этой страницы: Разработка ПО для банковских кредитных организаций . Студенческий форум Физфака МГУ > Общий > Работа . ... Компания " Программные системы и технологии ", один из лидеров отечественного рынка программного обеспечения (ПО) для банковских кредитных организаций, ищет новых сотрудников. Основные направления работы Компании : . ... Обязательно знание: CУБД ORACLE, C# в среде Microsoft.NET Framework, опыт разработки клиент-серверных приложений, в том числе WEB. ...
Inhibition of Horse Liver Alcohol Dehydrogenase by Methyltin Compounds Pavel V. Bychkov, Tatyana N. Shekhovtsova*, Elena R. Milaeva M.V. Lomonosov Moscow State University, Chemistry Department, Leninskie Gory, 119992 Moscow, Russia. ... The experimental results of the study show that inorganic tin and methyltin substances induce slight inhibition of the catalytic activity of horse liver alcohol dehydrogenase (HLADH), unable to be improved during pre-incubation with the enzyme. ...
[
Текст
]
Ссылки http://analyt.chem.msu.ru/kinetics/papers/Inhibition%20of%20Horse%20Liver%20Alcohol%20Dehydrogenase%20Bychkov%20191-%202005.pdf -- 932.8 Кб -- 25.09.2008 Похожие документы
... V. Shirokova Numerical Solution of Piston-Like Oil Displacement for Periodic Systems of Oil Fields Development Vladimir Astafev, Andrey Kasatkin The Exploring of Kendari DHF Data for Screaning Disease Risk Assessment ... Construction in Determining Direct Method Strategy Masykur Kimsan, Morgan L. Setiady, Chandra Yudi Kusuma, Kurniati Ornam, Edi Cahyono Dynamical Systems with Variable ... Lemma 1 Systems of the form 12, 13 are dynamical system with zero mean variable dissipation. ...
Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005 Похожие документы
I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013 Похожие документы
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... July 10, 1998 . NGC 1531/2: Interacting Galaxies . ... Explanation: This dramatic image of an interacting pair of galaxies was made using the 1.5 meter telescope at the Cerro Tololo Inter-American Observatory near La Serena, Chile. NGC 1531 is the background galaxy with a bright core just above center and NGC 1532 is the foreground spiral galaxy laced with dust lanes. ... These galaxies lie close enough together so that each feels the influence of the other's gravity. ... About APOD > . ...
... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors such as economic, ecological and political aspects of society. ... Play. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf -- 138.9 Кб -- 06.07.2014 Похожие документы