.

Еще в разделе: (Показать все результаты (>7) - lab110.imec.msu.ru/ )

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>9) - ndsipu.cmc.msu.ru/ )

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>27) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

Disjoining pressure of an electrolyte film confined between semipermeable membranes Salim R. Maduar and Olga I. Vinogradova Citation: The Journal of Chemical Physics 141, 074902 (2014); doi: 10.1063/1.4892758 View online: http://dx.doi.org/10.1063/1.4892758 View Table of Contents: http://scitation.aip.org/content/aip/journal/jcp/141/7?ver=pdfcov Published by the AIP Publishing Articles you may be interested in Order of wetting transitions in electrolyte solutions J. Chem. ... Chem.- ... Phys. Commun. ...

Еще в разделе: (Показать все результаты (>49) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/JCP2013.pdf

... In addition to the direct effect of acidic solutions on tree crowns, resulting in tissue damage and leaching of metabolites, the acid impact modify soil properties, which is believed to be the most important in forest degradation. ... We assessed critical loads of acid deposition and their exceedance for forest soils in the European part of the former Soviet Union using a simple balance method and mapped them within 1.0°x0.5° longitude per latitude grid cells. ...

Еще в разделе: (Показать все результаты (>34) - eco.soil.msu.ru/ )

• Forest Soil Response to Acid Deposition
• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION
• THEORETICAL PRINCIPLES AND METHODS OF REMEDIATION OF SOILS POLLUTED WITH HEAVY

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>14) - mph.cmc.msu.ru/ )

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>37) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80521.pdf
• http://www.library.biophys.msu.ru/PDF/80522.pdf
• http://www.library.biophys.msu.ru/PDF/80551.pdf

... Пример: ?Ни фига себе сайт $shocked$?. ... Link] 31.07.06 11:46:19 I/O Admin : . ... Наш сайт теперь включен в Каталог Яндекса!! ... META http-equiv="Content-Type" content="text/html; charset=windows-1251">. ... Link] 16.07.06 15:42:32 Site Content Admin : . Пора готовить сайт к началу учебного года. ... Link] 29.06.06 00:25:01 AlexeY : . ... META http-equiv="Content-Type" content="text/html; charset=win-1251"> . ... Присылайте свои материалы, пополняйте коллекцию, пожалуйста! ... 2016, DMVN . ...

Еще в разделе: (Показать все результаты (>49) - www.dmvn.mexmat.net/ )

... Scientific goals . Cosmic rays of extremely high energy . ... Gamma-bursts . Magnetospheric particles and radiation conditions . ... The Earth?s atmosphere is ?a target? for different types of space radiation. ... In the atmosphere high energy particles produce cascades of the secondary particles ? ... Gamma-bursts also produce their ?response? in the atmosphere in the form of Сherenkov radiation. ... Studies of the described above phenomena is the main goal of the ?Lomonosov? satellite. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• Program of the experiment | Университетский спутник "Ломоносов"
• Gamma-bursts | Университетский спутник "Ломоносов"

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>21) - psyberlink.flogiston.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>21) - iconolat13.phys.msu.ru/ )

• Program topics
• Foreword
• Program overview

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>11) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/adv_networks_openflow_tasks15.pdf
• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

Home Search Collections Journals About Contact us My IOPscience The role of scattering on atomic nucleus and of electron state entanglement in single ionization of He by ion impact This article has been downloaded from IOPscience. ... In inelastic scattering, due to the orthogonality of one-electron states, the transitions of different electrons are summed in the amplitude with all other electrons non-active. ... Chem. 45 125. where fppf is the ordinary amplitude of elastic scattering. ...

Еще в разделе: (Показать все результаты (>119) - danp.sinp.msu.ru/ )

• Статьи, подготовленные для публикации в журнале Nuclear Instruments and Methods

... Новости . Объявления . Контакты . ... Расписание . О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . Расписание экзаменов 415 группы. ... Кафедра системного анализа ВМК МГУ создана в 1992 году. Организатор и заведующий кафедрой - лауреат Ленинской премии, заслуженный профессор МГУ, академик РАН Александр Борисович Куржанский . ...

Еще в разделе: (Показать все результаты (>4) - sa.cmc.msu.ru/ )

• Send page by email | Кафедра системного анализа ВМК МГУ
• Выпускники | Кафедра системного анализа ВМК МГУ
• Сотрудники кафедры | Кафедра системного анализа ВМК МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

Electronic Proposal Submission Service - EPSS preparation and submission guide - Release Date: 5 May 2008 Table of Contents 1 1 .1 . ... Using PIC in EPSS.. ... 29 EPSS help desk Phone: +32 2 23 33 760 Email: support@epss-fp7.org EPSS User Manual Released on 5 May 2008 page 2 of 29 1 EPSS Preparation ­User's Guide The EPSS (Electronic Proposal Submission Service) allows Proposers to create their proposal completely on-line without downloading or saving anything on their local personal computer. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/ERC_rules.pdf
• http://ideas.msu.ru/docs/Evaluation_panels.pdf

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>21) - www.mse-msu.ru/ )

... Surface plasmon-polaritons (SPPs) is a collective oscillation of light and electrons that propagate at the boundary between metal and dielectric. ... Ultrafast Laser Pulse Shaping by Plasmonic Crystals . In our group, controllable reshaping of a femtosecond laser pulse reflected from a plasmonic crystal based on 1D polymer grating with period of 750 nm covered by 50љnm silver film. ... Pulse duration ? ... nonlinear crystal. ... Ultrafast Polarization Pulse Shaping with Plasmonic Crystals . ...

Еще в разделе: (Показать все результаты (>77) - nanolab.phys.msu.ru/ )