... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Gas evolution from Brazilian rock crystal and quartz as raw materials for producing silica glass . ... Gas content, along with the content of element impurities and the content of mineral inclusions, is one of the most important characteristics of quality for quartz raw materials in producing high-quality silica glass. Gas evolution from rock crystal and vein quartz from Brazil as quartz raw materials for producing high-quality silica glass has been studied. ...
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures . Tatiana A. Dolenko . ... Modern methods and possibilities of laser Raman spectroscopy. ... Vibrational spectroscopy of water solutions of amphiphilic compounds. ... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. ... Comparison of Input Data Compression Methods in Neural Network Solution of Inverse Problem in Laser Raman Spectroscopy of Natural Waters. ...
... Программа повышения квалификации ?Исследование природы вместе с детьми? ... День леса - 2013 . ... Содержание сборника, 2004 . ... из сборника Вместе со всей планетой , Пущино 1995 . ... Загадки и тайны мира природы очень интересны детям, даже самым маленьким. ... В 1995 г. мы вместе с учеными подмосковного города Пущино помогали школьникам выступить в роли экологических наставников для малышей . Заметка об этой работе была опубликована в журнале ЮНЕСКО Connect . ...
... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...
NANO AND GIGA CHALLENGES IN MICROELECTRONICS: RESEARCH OPPORTUNITIES IN RUSSIA . ... Moscow, September 11-13, 2002 . This meeting will bring together scientists and engineers from academia, industry and national labs to discuss recent developments, and explore potential for collaboration solving the most challenging scientific and engineering problems in microelectronics. ... atomic scale design: theory and experiment . highest frequency electronics . ... non-silicon materials and devices . ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
... COMPLEX SYSTEMS BIOPHYSICS Traveling Waves in a Piecewise Linear ReactionDiffusion Model of Excitable Medium E. P. Zemskova and A. Yu. ... Two main types of wave have been considered: a single pulse and a periodic sequence of pulses (wave trains). ... Calculations show that two pulses can coex ist, fast and slow. ... PERTURBED REACTIONDIFFUSION SYSTEM: PULSE TRAINS The wave profile oscillations described above were caused by the presence of the second component in the model equations. ...
... Printed in U.S.A. NATURE OF NUCLEAR RINGS IN UNBARRED GALAXIES : NGC 7742 AND NGC 7217 O. K. Sil'chenko and A. V. Moiseev Special Astrophysical Observatory, Nizhnij Arkhyz 369167, Russia; moisav@sao.ru Received 2005 ... Isaac Newton Institute of Chile, Moscow Branch, Moscow 119992, Russia; olga@sai.msu.su ABSTRACT We have studied an unbarred Sb galaxy with a nuclear star-forming ring, NGC ... 1 7217, Pos. ... Left: Stellar velocity dispersion map for NGC 7217 according to the SAURON...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... 2, JUNE 2007 1185 Commissioning of the CMS Magnet Domenico Campi, Benoit CurИ, Andrea Gaddi, Hubert Gerwig, Alain HervИ, Vyacheslav Klyukhin, Gilles Maire, Goran Perinic, Philippe BrИdy, Philippe Fazilleau, Francois Kircher, Bruno LevИsy, Pasquale Fabbricatore, Stefania Farinon, and Michela Greco Abstract--CMS (Compact Muon Solenoid) is one of the large experiments for the LHC at CERN. ... The construction of the CMS Magnet, and of the coil in particular, has been completed last year. ...
[
Текст
]
Ссылки http://lav01.sinp.msu.ru/nir/papers/IEEE_ASC_17_2_2007_1185_1190.pdf -- 496.1 Кб -- 08.04.2008 Похожие документы
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
... Seminar archive . ... Seminar archive 2012 9 November . ... Липунов В. М. ( МГУ, ГАИШ МГУ ) . ... 10 min. ... Ефремов Ю. Н. ( ГАИШ МГУ ) . ... Тюрина Н. В. ( ГАИШ МГУ ) . ... It was proposed in 2003 that origin of these arcs was due to the bow shock from the jet, which is intermittently fired by the Milky Way nucleus and during the last episode of its activity the jet was pointed to the LMC. Quite recently evidence for such a jet has really appeared. ... All seminars: . ...
... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...