... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...

Еще в разделе: (Показать все результаты (>2) - ndsipu.cmc.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the proteinґprotein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>23) - www.library.biophys.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>1566) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>30) - www.msm.biophys.msu.ru/ )

arxiv:1407.1049 Звездная активность, маскирующаяся под планеты в зоне обитаемости вокруг красного карлика Gliese 581 (Stellar Activity Masquerading as Planets in the Habitable Zone of the M dwarf Gliese 581) . Authors: Paul Robertson et al. arxiv:1407.1115 Земноподобная планета на орбите ~1 а.е. вокруг одной из звезд двойной с орбитой ~15 а.е. (A Terrestrial Planet in a ~1 AU Orbit Around One Member of a ~15 AU Binary) . ... Authors: V. Joergens, M. Bonnefoy, Y. Liu, A. Bayo, S. Wolf . ...

Еще в разделе: (Показать все результаты (>166) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/bethe.pdf
• http://xray.sai.msu.ru/~polar/sci_rev/0609.html

Your browser doesn't support JavaScript. For best view you need to enable JavaScript. ... Theory of Vibrations II by P.V. Elyutin . Nonlinear Optics by O.A. Aktsipetrov . Nonlinear Dynamics by P.V. Elyutin . Theoretical Foundations of Quantum Radiophysics by P.V. Elyutin . Condensed Matter Physics by A.A. Nikulin . ... Optics and Nonlinear Optics of Photonic Crystals and Superlattices by O.A. Aktsipetrov and A.A. Fedyanin . ...

Еще в разделе: (Показать все результаты (>18) - shg.phys.msu.ru/ )

• People Info

... Research . ... Home Research Grants and Contracts . ... Support of leading research schools (grant No. ... Russian Foundation for Basic Research grants in 2002-2013 . ... 12-03-00653:   PI -  Natalia V. Avramenko . ... jointly with the Institute of General and Inorganic Chemistry of RAS and Moscow Institute of radiotechnics, electronics and automatics) . Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>8) - td.chem.msu.ru/ )

• Carbamide Laboratory of Chemical Thermodynamics
• Our Partners Laboratory of Chemical Thermodynamics

... Leontiev Alexander Ivanovich - Academician of the Russia Academy of Science, Doctor of Science, Professor, Principal research scientist. ... Vinogradov Yurii Alecseevich - Candidate of science, Leading research scientist, Institute of Mechanics, MSU . ... Arbekov Alexander Nikolaevich - Candidate of science,Assistant professor, MSTU n.a. N.E. Bauman . ... Zditovets Andrey Gennadievich - Candidate of science, Senior research scientist, Institute of Mechanics, MSU . ...

Еще в разделе: (Показать все результаты (>2) - termogaz.imec.msu.ru/ )

• aboutLab

The head of the team - Vladimir A.Veselovsky , Professor of Biophysics . ... M.V.Lomonosov State University, Moscow, Russia . ... Induced by different factors (light, H 2 O 2 , KMnO 4 , electric current etc.) luminescence of roots and leaves was used for investigation of mechanisms of damage in cells and for plant resistance determination. ... Moscow. Znanie (in Russian). 1964. 48 p. Tarusov B.N., Veselovsky V.A. Ultra Weak Light Emission of Plant and its Practical Significance. ...

Еще в разделе: (Показать все результаты (>6) - www.biophys.msu.ru/ )

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>115) - sp.cs.msu.ru/ )

• Темы докладов, курсовых и дипломных работ. 1998-1999 учебный год
• RAMPA - CASE for portable parallel programs development
• Performance Analyzer. Detailed design

... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>14) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

... Research . ... 1972 ? current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol?zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)?. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>15) - lcl.srcc.msu.ru/ )

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>3) - elast.math.msu.su/ )

. Коуровская тетрадь . Новосибирск . Another list of open problems . New York .

Еще в разделе: (Показать все результаты (>14) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:publ_engl.html | Кафедра высшей алгебры
• shared:seminars_lnd | Кафедра высшей алгебры

... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...

Еще в разделе: (Показать все результаты (>3) - lcc.chem.msu.ru/ )

• Current Projects

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>13) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Полезные ссылки
• Название сайта

Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...

Еще в разделе: (Показать все результаты (>12) - psyberlink.flogiston.ru/ )

Новый сайт Института русского языка и культуры (ЦМО до 2013 года) доступен по адресу www.irlc.msu.ru . About CIE MSU . ... Useful Information . ... For Teachers . ... Vestnik CIE (in Russian) . ... Alumni . About Moscow University . ... Graduates of CIE MSU former Pre-University Department of Moscow State University is a huge friendly family spread worldwide. ... In 2004 when the 50th anniversary CIE MSU was celebrated, many graduates arrived to take part in the anniversary conference. ...

Еще в разделе: (Показать все результаты (>18) - www.cie.ru/ )

• Our Staff :: About Center for International Education :: CIE
• Students? Life :: CIE