... public interface Logger . ... Log messages are tagged with a numeric logging level, selected from the ordered list of constants below. ... Log level for messages indicating critical conditions. static int . ... log (int level, java.lang.String message) . ... Log level for messages indicating a normal but significant condition. public static final int INFO . ... Messages tagged with level above maxLevel may be discarded. public void log (int level, java.lang.String message) throws java.io.IOException...

Еще в разделе: (Показать все результаты (>29) - angel.cs.msu.su/ )

• : Package ucar.multiarray
• PhD Summer School on Scentific Computing
• ExtensionFileFilter

Lab . Main page News People . ASA . Master . Master net Homepage . ... Lomonosov Moscow State University Sternberg Astronomical Institute . ... MASTER . ... Lomonosov (ShOK) . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . People, who work in lab . Latest news and news archive . ... 27.02.2012 . ... All news ...

Еще в разделе: (Показать все результаты (>17) - master.sai.msu.ru/ )

• YaB-100 - Participants
• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists
• International Workshop ?Robotic observatories?

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Editorial: Milestones in March on the path to sustainable development Cooperation in the development of deposits in the Arctic Climatic features in Russia 2011 Public Chamber against the expansion of Moscow On the eve of the conference Rio +20 Sochi: the development of green construction Russia 's economic zone in the Arctic Jubilee anniversary of World Water Day Teaching material on climate change Hazards of offshore ... The Arctic shelf is very rich with hydrocarbon resources....

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• http://www.eng.geogr.msu.ru/science/newsletter/8_12.pdf
• http://www.eng.geogr.msu.ru/science/newsletter/1_12.pdf
• Department of Cryolithology and Glaciology

... BR = $mysql_err_msg ; exit; }//if if ($check_zero_rows == true) { if (mysql_num_rows($ res ) == 0) { if (!empty($mysql_zero_rows_err_msg)) {echo BR = $mysql_zero_rows_err_msg ; } if ($die_on_zero_rows == true) {exit; } }//if }//if if ($return_ res == 1) { return $ res ; }//if if ($return_ res ==2) { return mysql_fetch_array($ res ); }//if if ($return_ res == 3) { return mysql_num_rows($ ...

Еще в разделе: (Показать все результаты (>20) - genphys.phys.msu.su/ )

• Микромаг - сервер

THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...

Еще в разделе: (Показать все результаты (>4) - www.iisi.msu.ru/ )

Site navigation: . ... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. ... The problem of preparing entangled pairs of polarization qubits in the frequency-nondegenerate regime?, ... Download [ help ]: . Download paper: doi page . Download paper: Full text . ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>64) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest

... ESA Space Weather Activities | ... Space Environments and Effects Analysis Section, | ... Introduction THE NATURAL SPACE ENVIRONMENT REPRESENTS A CONSIDERABLE HAZARD FOR SPACECRAFT AND THE EUROPEAN SPACE AGENCY (ESA) HAS FOR MANY YEARS TAKEN MEASURES TO ENSURE THAT ITS SPACECRAFT ARE ABLE TO SURVIVE AND OPERATE IN IT. ... 2.2 Radiation Effects As in other space agencies, ESA's concerns with space weather effects probably began with concerns over radiation effects on spacecraft systems. ... 2000). ...

Еще в разделе: (Показать все результаты (>78) - www.kosmofizika.ru/ )

• A Dictionary of Measures, Units and Conversions

... Lectures : Nanomagnetism / Fundamentals I and II 1. a. b. c. d. 2. a. b. c. d. 3. a. b. c. d. e. Introduction Diamagnetism Paramagnetism Ferro-, Ferri- and Antiferromagnetism Magnetic susceptibility and permeability Magnetic order and magnetic interactions Magnetic exchange (direct, indirect, and superexchange) Dipolar magnetic interaction Spin-orbit interaction Local magnetic moments and spin-polarized electron band structure ...

Еще в разделе: (Показать все результаты (>12) - nano.msu.ru/ )

• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology

... C. Gibbons, M. Locke: Cupid and Death - Fifth Entry . К. Гиббонс, М. Локк: Купидон и Смерть - Явление пятое . ... For fear Cupid and Death be reconcil'd . ... Nature doth here her own complexion spread, . ... Природою им дан лишь облик их, . ... Upon the sudden, a solemn music is heard, and Mercury seen descending upon a cloud, at whose approach the others creep in amazed. ... Внезапно слышится торжественная музыка, и появляется Меркурий , спускающийся на облаке. ... Cupid . ... Cupid, Death . ...

Еще в разделе: (Показать все результаты (>13) - music.genebee.msu.ru/ )

• C. Gibbons, M. Locke: Cupid and Death - Entry 4

The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches ­ Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control ­ Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК . ... PHYSICAL MODELS IN DNA SCIENCE . ... This process is useful for both physics and biology. ... As an example, we took the problem of interaction of nonlinear physics and mathematics with DNA science, and we discuss what new ideas, physical models, mathematical equations gave this interaction. ... New dynamical models . ... K/2) S n {[ 2R 2 0 [1- cos( Q n,1 - Q n-1,1 )] + u 2 n,1 + u 2 n-1,1 - 2 u n,1 u n-1,1 cos( Q n,1 - Q n-1,1 ) - . ... z n,2 - z n-1,2 | ...

Еще в разделе: (Показать все результаты (>19) - www.library.biophys.msu.ru/ )

• МОДЕЛИРОВАНИЕ ВЗАИМОДЕЙСТВИЯ МАГНИТНОГО ПОЛЯ С ОБЪЕМНЫМИ ВЯЗАНЫМИ СТРУКТУРАМИ

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>2) - elast.math.msu.su/ )

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>12) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...

Еще в разделе: (Показать все результаты (>3) - lcc.chem.msu.ru/ )

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>8) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Полезные ссылки

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>17) - suny.msu.ru/ )

• Центр по делам России и США :: Публикации

... News . ... 22.11.2005 PhD student Pavel Meskin and student Victor Maximov have participated in V scientific school "Actual problems of inorganic chemistry and materials science" which was held at Zvenigorod (Russia) from 18 to 22 November 2005. 01.09.2005 We have new colleague - first year student of Material Sciences Department Nikita Konoplev have started his scientific work at our group. ... Nicolas N. Oleynikov became a corresponding member of the Russian Academy of Sciences in 2000. ...

Еще в разделе: (Показать все результаты (>15) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory - Supramolecular and Cluster Compounds
• Inorganic Chemistry Division

... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>14) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Dictionary for Text Understanding and Summarization