... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...
... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...
. This crossword was created with EclipseCrossword - www.eclipsecrossword.com . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . Этот кроссворд был создан freeware EclipseCrossword
... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...
... О МЛЦ МГУ . ... Абстракт: Basic quantum information measures involved in the information analysis of quantum systems are considered. It is shown that the main quantum information measurement methods depend on whether the corresponding quantum events are compatible or incompatible. For purely quantum channels, the coherent and compatible information measures, which are qualitatively different, can be distinguished. A general information scheme is proposed for a quantum-physical experiment. ...
Форум МГУ Главная Форум > общие > . ... Ответов Просмотров . ... LalBiassE , 4 сен 2012 . Ответов: . ... Просмотров: . ... LalBiassE . 4 сен 2012 . Fewepoxy , 4 сен 2012 . ... Fewepoxy . ... Bimmemituefly , 4 сен 2012 . ... looraPlult , 4 сен 2012 . ... teensecub , 4 сен 2012 . ... Критерий сортировки тем: Дата последнего сообщения в теме Дата создания темы Название темы (по алфавиту) Число ответов Число просмотров Число благодарностей за первое сообщение . ... Главная . Форум . ...
... 1996. ... Contents . CONTENTS . ... Would Russia rise again? ... Alenaces to Russia's security . ... and the 'Helms - Burton' bill . ... and certain problems of the internal mission . Parlamentarism in Russia and abroad . ... of constitutionalism in Russia. ... Bills and legislative proposals. ... How to change the Constitution - on the . constitutive revision and amendements to the Constitution . ... Certain aspects of the federal bill on the minimum . ... in Oktober-November 1996 . ...
... Работы участников . Дипломы . ... 29 октября 2011 года в Московском университете прошел парад-презентация ?Калейдоскоп культур?, которым завершился наш Первый онлайн-фестиваль дружбы ?Русский язык ? ... Прямое онлайн-включение состоялось, на связи с нами находились три вуза из разных городов (Московский государственный технический университет имени Н.Э. Баумана, Саратовский государственный љмедицинский университет имени В.И. Разумовского и Казанский (Приволжский) федеральный университет). ...
... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
MASS Software Version 2.04 User Guide V.Kornilov, N.Shatsky, O. Voziakova Decemb er 30, 2003 Contents 1 MASS software op eration overview 1.1 Main features of measurement pro cess with MASS instrument . ... 2 Installation, tuning and startup 2.1 Installation of the MASS software Turbina 2.2 Editing the configuration file . ... 4.2 Output data in MASS Software . ... 4.2 Output data in MASS Software The output of Turbina program op erating the MASS device is directed to an ASCI I file called mass-file. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
University Satellites and . Space Science Education . ... Use of microsatellite technology in aerospace education by the example of BAUMANETS microsatellite project . ... Launch is scheduled for March 2006. ... Over 20 students graduated from BMSTU and found work in leading Russia s and international aerospace companies. ... Meanwhile, modern labor market in aerospace shows increasing requirements towards quality of university education. ...
MEIS : 2007 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...