Method of Laser Interference Microscopy for investigation of erythrocytes Yusipovich A.I., Bryzgalova N. Yu., ... The LIM method allows to study the native contrastless biological objects without fluorescent probes. It also makes possible to estimate quantitatively change in the optical density, thereby providing not only qualitative but quantitative data at cell different states. ... The finding results allow to use LIM as appropriate method for investigation of erythrocytes condition. ...
... N 1 Contents Buzhilova A.P. Anthropology at the Moscow University (to the 90 anniversary of Institute of Anthropology of the Moscow State University) (p. 4) Review. Historical development of the main trends in scientific research of the Institute and Museum of Anthropology, Lomonosov Moscow State University, is discussed. ... The article discusses the formation and development of ethnic anthropology in the Research Institute of Anthropology, Lomonosov Moscow State University from 1922 onwards. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2013_1.doc -- 61.5 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2013_1.doc -- 61.5 Кб -- 23.07.2015 Похожие документы
ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
T he main building of Moscow State at the Vorob?evy Gory university campus (Stalin-like skyscraper) hosts a number of faculties, namely, Faculty of Mathematics and Mechanics, Faculty of Geography, Faculty of Geology, and Museum of Earth. ... Faculty of Physics . ... Humanitarian Building (Philological Faculty, Faculty of Philosophy, Faculty of History, Faculty of State Government, Library for the Faculties of Humanities) . ... D.V. Skobel?tsyn Research Institute of Nuclear Physics (SINP) . ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...
... M.V.Lomonosov Moscow State University . ... An international conference " Analysis and Singluratites " dedicated to the 75th anniversary of V.I.Arnold will be held at the Steklov Mathematical Institute from 17 to 21 December 2012. Members of our department participate actively in this event. ... Our department participated actively in organising the 2nd International Conference " K-Theory, C*-algebras and Topology of Manifolds " in Nankai University (Tianjing, China) on 7-11 May 2012. ...
... Opportunities for Research Section Financial and Legal Mechanisms for Developing Russia in the Context of Global Political and Economic Instability Chairperson: Professor Alla Bobylyova Head, Department of Financial Management, School of Public Administration Lomonosov Moscow State University Secretary: Olga Lvova Department of Russian History, School of Public Administration Lomonosov Moscow ...
[
Текст
]
Ссылки http://www.spa.msu.ru/uploads/files/konferenzii/_program_conference_2013_eng.pdf -- 326.1 Кб -- 21.05.2013 Похожие документы
The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...
Measurement of Sky Brightness at the Iranian National Observatory Davoud Afshari1 and Sadollah Nasiri1,2 1Physics Department, Zanjan University, Zanjan 45195-313, Iran; Institute for Advanced studies in Basic Science (IASBS), Zanjan 45195-1159, Iran; Measurement of light pollution 2 Introduction Among 34 candidate sites at the central part of the country, 5 sites namely Garkesh (in Kashan ), Kolahbarfi(in Kashan ), Deynava (in ... One of these is light pollution. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... 2 · , , · · , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...