Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>113) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/nl_36.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>19) - ferro.phys.msu.ru/ )

... Strike-slip magmatic duplexes . ... During 1996-1998 we have carried out a complex field and laboratory study of particular class of the geological objects, which we named strike-slip magmatic duplexes (SSMD), in limits of the Eastern Urals, Central Kazakhstan and Kola-Karelia region. ... 2) We recovered within the Eastern Urals a series of geological objects identidied as SSMD of different age and of different deepness, and studied them in detail due to field investigations. ...

Еще в разделе: (Показать все результаты (>10) - sbmg.geol.msu.ru/ )

• ТРЕХМЕРНОЕ ГЕОЛОГИЧЕСКОЕ КАРТИРОВАНИЕ: ВВЕДЕНИЕ В ПРОБЛЕМУ

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>68) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>24) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc

Academic English English for Students of Mathematics and Mechanics Supplementary Exercises Part II L.N.Vygonskaya O.Y.Sviridenko MSU Moscow 2012 Academic English (part 2 of 4) The tasks are based on ?English for Students of Mathematics and Mechanics? by Y.I. Mindeli. Unit 1 Task 18. ... 1 Armer, T. Cambridge English for Scientists, Cambridge, 2011 4 Academic English (part 2 of 4) Unit 7 Midterm test Unit 8 (At home) Make up a list of linking words you know and bring it to class. ... Task 15 p.93. ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Reports.pdf

... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...

Еще в разделе: (Показать все результаты (>5) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>31) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>14) - hit-conf.imec.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

LabVIEW. ... National Instument DAQ, LabVIEW LPT COM , GPIB . ... RS-232 GPIB . RS-232 / GPIB, LabVIEW. ... RS-232 IEEE-488 (GPIB). ... RS-232 , DTE (Data Terminal Equipment) -- ( ), -- DCE (Data Communications Equipment) -- ( ). DTE () -- , DCE () -- , RS-232 (, , ), . ... LabVIEW, National Instruments http://ni.com/support/gpib/versions.htm. ... VISA Read COM Receive GPIB ), , . VISA Write Send COM GPIB . ... VISA Read Receive , ?read buffer? ( ?data string? GPIB) Create\Indicator. ...

Еще в разделе: (Показать все результаты (>9) - www.test.physchem.msu.ru/ )

... 2 Ї ґ , , Ї ґ Ї ґ , 03.12.2015 . ... 14 03.12.2015 Ї Ї Ї 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )