... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Конференции: Календарь / Материалы . ... Геология >> Геология океанов и морей | Анонсы конференций . ... Международная конференция по проблемам Арктических окраин (International Conference on Arctic Margins, ICAM IV) . 30.09.2003 | ... Конференция "PACON 2003: Ocean Capital Year" . ... Конференция "PACON 2003: Ocean Capital Year", 29 июня 2 июля 2003 г., Тайвань. ... Геология . Геология океанов и морей . ...

Еще в разделе: (Показать все результаты (>166) - phys.web.ru/ )

• XXXIV Международный Геологический Конгресс (34th International Geological
• Все о геологии :: Анонсы конференций - Планетология ()
• Все о геологии :: Анонсы конференций - Минералогия ()

Either several (at least two) Intel/AMD-based computers having identical or similar hardware configuration and running in the local network environment under the control of Windows NT 4.0, Windows 2000, Windows XP, Windows Server 2003, Windows Vista, Windows Server 2008, or Windows 7. ... The 32-bit NT-MPICH package (the part of MP-MPICH) must be installed, including MPI dynamic link libraries and cluster management service, on all computers to be used to run PC GAMESS/Firefly in parallel. ...

Еще в разделе: (Показать все результаты (>76) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries

Еще в разделе: (Показать все результаты (>20) - teconv.srcc.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>385) - www.chemport.ru/ )

• Diy store chains of russia analytic database маркетинговое исследование рынка
• "Вакансия standards office manager" - вакансия в разделе "Работа для химиков"
• "Phd student in the institute of physical chemistry in warsaw" - вакансия в

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>4) - phys.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>16) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department
• Victor Oknyanskij
• SAI graduates 1982

... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...

Еще в разделе: (Показать все результаты (>2) - atm007-3.phys.msu.ru/ )

... Публикация в Интернете электронных журналов . ... Использование дистанционных образовательных технологий в обучении . ... Использование дистанционных образовательных технологий в преподавании химии . ... Информация о дистанционном обучении на Химическом факультете МГУ . ... Возможность обучения на основе фактически индивидуальных занятий с преподавателями выбранного вуза . ... Изучение вопросов восприимчивости дистанционного обучения и адекватности оценок знаний методом дистанционного тестирования ....

Еще в разделе: (Показать все результаты (>91) - inpro.msu.ru/ )

... Accelerating Structure Q1 Q2 Al foil CF Abstract During the startup of injector of 70 MeV pulsed Race Track Microtron the OTR beam visualization and diagnostic system based on PC was used. ... Fast parallel digital bus is used to acquire image and to control CCD camera. ... The beam parameters such as beam size, profile and emittance have been measured with the help of the system. mirror CCD camera Pb shield Figure 1: Layout of experiment: Q1, Q2 ґ quadrupoles, FC ґ Faradey cup. ... Figure 3. ...

Еще в разделе: (Показать все результаты (>382) - rtm-cs.sinp.msu.ru/ )

• http://rtm-cs.sinp.msu.ru/publications/pte2007/pte1_eng.pdf
• Visible bell mini-Howto
• Qt API Structure Overview

... О UNИX . ... 52 Structure in the wiki . Неизменяемая страница . ... Many conventional websites use very branched structures with many hierarchy levels. In wikis linking is heavily used. ... all important topics are located in main pages. only if a topic has many subtopics (which aren't main topics), subpages are used. ... creation of a basic structure of pages. definitions of name conventions for page names. decision to use CamelCase or free links?. definitions of important categories. ...

Еще в разделе: (Показать все результаты (>437) - uneex.mithril.cs.msu.su/ )

• Conferences/Pereslavl2012 - UNИX
• Conferences/SummerSchool2010 - UNИX
• Index of /static/AltDocs_unix_base_admin/images

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . Prof. Dr. Olga I. Vinogradova . Moscow State University . ... Research . ... Professor, Director of Laboratory . ... Type of research: . ... She then joined the group of Prof. Boris V. Derjaguin at the Laboratory of Physical Chemistry of Modified Surfaces, part of the A.N.Frumkin Institute of Physical Chemistry and Electrochemistry (Russian Academy of Sciences) as a research fellow. ...

Еще в разделе: (Показать все результаты (>45) - nanofluidics.phys.msu.ru/ )

• Maduar
• Theses
• Demekhin

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Plan the Company's Future . ... Consider how much differentiation there should be in the company. ... Determine how formal the company will be structured? ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>136) - innovation.msu.ru/ )

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2237) - swx.sinp.msu.ru/ )

• Index of /models/database/db/001126
• Index of /models/database/db/010402
• Index of /models/database/db/001124

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>22) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

220. PARALLEL.RU - Новости, выпуск #259 [10/02/2009]