... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI ? ? - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>6) - angel.cmc.msu.ru/ )

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>13) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

.

Еще в разделе: (Показать все результаты (>42) - lav01.sinp.msu.ru/ )

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>17) - temporology.bio.msu.ru/ )

• A FREGIMO AMISSA - Научный адъ

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>9) - ferro.phys.msu.ru/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>26) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/pravila_eng.doc

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>8) - polit.msu.ru/ )

• Новости факультета

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...

Еще в разделе: (Показать все результаты (>15) - cryolab.phys.msu.ru/ )

• About laboratory
• Nanoelectronics
• Molecular single-electronics

. Показ слайдов для альбома :: Защита дипломных работ 22.12.2008 . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Список альбомов Альбом: Защита дипломных работ 22.12.2008 . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>45) - hep.msu.dubna.ru/ )

• Показ слайдов для альбома :: Cеминар Нобелевского лауреата по физике Дэвида
• Показ слайдов для альбома :: Экскурсия студентов третьего курса в Дубну. Осень
• Показ слайдов для альбома :: Картинки

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>8) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>125) - www.enzyme.chem.msu.ru/ )

• Efremenko E.N.
• Gudkov D.A.
• Lyagin I.V.

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

. Показ слайдов для альбома :: 40-летие Филиала МГУ . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Филиал МГУ в Дубне Альбом: 40-летие Филиала МГУ . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>6) - www.msu.dubna.ru/ )

• Показ слайдов для альбома :: Школы
• Показ слайдов для альбома :: ОИЯИ
• Показ слайдов для альбома :: В аудиториях филиала

THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...

Еще в разделе: (Показать все результаты (>24) - www.sai.msu.ru/ )

• http://www.sai.msu.su/gcvs/gcvs/nl74/readme

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• teachers

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• StructAlign help

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>9) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ґ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

... February 22, 1999 . NGC 1316: After Galaxies Collide . ... WFPC2 , HST , NASA . ... A preliminary inspection indicates that NGC 1316 is an enormous elliptical galaxy that started devouring a smaller spiral galaxy neighbor about 100 million years ago. ... Most elliptical galaxies have more and brighter globular clusters than evident in NGC 1316 . ... One hypothesis therefore holds that these globulars survive from an even earlier galaxy that was subsumed into NGC 1316. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>27) - www.arcetri.astro.it/ )

• APOD: November 9, 1999 - Spiral Galaxies in Collision
• APOD: April 9, 1999 - WR 104: Pinwheel Star