... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>7) - td.chem.msu.ru/ )

... Publications . Journals . ... Borisov A. V. , Mamaev I. S. , Treschev D. V. Rolling of a rigid body without slipping and spinning: kinematics and dynamics . Russian Journal of Nonlinear Dynamics, 2012, vol. 8, no. 4, pp. ... Borisov A. V., Mamaev I. S., Treschev D. V., Rolling of a rigid body without slipping and spinning: kinematics and dynamics, Russian Journal of Nonlinear Dynamics, 2012, vol. 8, no. 4, pp. ... ISSN (print): . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>124) - ics.org.ru/ )

... Таня Трубичева, Коля Чеботарев, Сергей Меженный, Андрей Лебедев . ... Слева направо: Паша Зинюков, Булат Мавлюдов, Галя Ивутина (выше), Муся Григорян, Саша Игнатьев. ... Слева направо: 1)Аня Ноздрачева, 2)Дима Китаев, 3)Миша Ноздрачев, 4)Женя Цибиков, 5)Костя Фирсов, 6)Володя Трифонов, 7)Тамара Голубицкая, 8)Таня Михайлина, 9)Саша Игнатьев, 10)Валя Рябинкина, 11)Таня Чеботарева, 12)Оля Гусева, 13)Коля Чеботарев. ... Таня Гужва, Таня Немченко, Даниэль Усиков перед спуском в снежную . ...

Еще в разделе: (Показать все результаты (>8) - optics.sinp.msu.ru/ )

• polist99
• zagedan

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>61) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Sergei Shishkin

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>90) - npidb.belozersky.msu.ru/ )

• Index of /data
• Index of /data/html_scop
• Index of /data/pdb_new

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>6) - discours.philol.msu.ru/ )

• Department

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

• Центр по делам России и США :: Новости

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

213. Invited speakers

214. Ученики Антона Клячко

215. http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc

216. Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/

217. http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf

218. http://hbar.phys.msu.ru/gorm/dating/mosaic.pdf

219. Solar Physics Department

220. http://www.eng.math.msu.su/download/Academic_English_part2.pdf