Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>101) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches
• MGUMUS -- Second International Conference of CIS IHSS on Humic Innovative
• MGUMUS -- Third Conference of CIS IHSS on Humic Innovative Technologies Humic

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

Wireshark Ї Ї Ї Ї Ї (Win, Mac, Linux) Open Source (http://www.wireshark.org) Ї Ї Ї ( ) Ї 2 1 Ї # usermod ґa ґG wireshark user Ї wireshark root user@host:~$telnet ya.ru 80 Trying 213.180.193.3.. ... MAC 2. MAC IP ARP 3. L4 Interface # 1 2 3 4 Domain # 1 1 Eth Address 00:00:00:00:00:0a 00:00:00:00:00:09 IPv4 Address 10.0.1.2 10.0.1.1 10.0.2.2 10.0.0.3 Flow # 1 2 Src Itf # 1:49153 3:49153 Dst Itf # 4:234 1:432 Protocol TCP UDP Edges 1-2 1-2 .. ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism Ї The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>13) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/files/rossipr12.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>7) - www.cmc-online.ru/ )

• ВМиК - Online! : Абитуриентам факультета ВМК МГУ - Варианты по английскому...

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>785) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf

. Prague, August 16, 2006 . Present classification : Suggested: . E, EA, EB, EW, EP E, EA, EC - contact (merging EB and EW), EP PN, WD, WR Remove from the classification, indicate through the spectral type or Remarks RS If such a star has eclipses, give notation like EA+RS, RS+EA . AR, D, DM, DS, DW, K, Remove from the classification; KE, KW, SD as a rule, these types in the GCVS are based on indirect evidence . ECLIPSING VARIABLES . (the description of the class should not mention close binarity)

Еще в разделе: (Показать все результаты (>100) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

Home Page Top ology on Graphs Title Page Contents Zhi Lu ? Institute of Mathematics, Fudan University, Shanghai. Page 1 of 22 Osaka, 2006 Go Back Full Screen Close Quit Home Page ї1. ... Title Page Contents Page 15 of 22 Go Back Full Screen Close Quit Home Page Basic problem (I) (, ): a coloring graph of type (n, n) with connected. ... Title Page Contents Page 20 of 22 Go Back Full Screen Close Quit Home Page Prop osition. ... Title Page Contents Page 22 of 22 Go Back Full Screen Close Quit ...

Еще в разделе: (Показать все результаты (>272) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/TTC/slides/terzic.pdf
• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/2009/Teleman-Introduction-mtph345.pdf
• http://higeom.math.msu.su/people/taras/TTC/slides/timashev-poster.pdf

. Rus / Eng . 0 . 2013 . Impact Factor . Log In or Register . Main . Staff . Publications . Journals . Conferences . Contacts . Main . Staff . Publications . Journals . Conferences . Contacts . Biography . title . Publications . Articles . Preprints . Back to the list . postgraduate student . Universitetskaya, 1, Izhevsk, 426034, Russia . l.n.pivovarova@gmail.com . description . Main . Staff . Publications . Journals . Conferences . Contacts . Institute of Computer Science Izhevsk, 2005 - 2016 .

Еще в разделе: (Показать все результаты (>104) - ics.org.ru/ )

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>3) - compmech.math.msu.su/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>2) - do.chem.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>87) - hbar.phys.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>52) - brain.bio.msu.ru/ )

• At closing the Congress. (With the Chief)
• Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) (former
• EEG feature extraction

Biological membranes. Structure, properties, functions Abstract Biological membranes, together with cytoskeleton, form the structure of living cell. ... Each membrane type contains a specific set of proteins - receptors and enzymes but the base of every membrane is a bimolecular layer of lipids (lipid bilayer) that performs in each membrane two principal functions: (1) a barrier for ions and molecules, and (2) structural base (matrix) for functioning of receptors and enzymes. ... Fig.2. ...

Еще в разделе: (Показать все результаты (>13) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/phys/med/engl_ver/evc_06ep.pdf
• Postdoctoral training (Neutronography)
• A GLIMPSE BACK INTO THE HISTORY

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS Wxt? v?€€xtzтxс4 g{x Ytvт€рч ?y T?рс уx?x tvvxІрxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

220. http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf