... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
Norwegian Libraries: . ... ARLIS - Kunstbib: Norwegian Art History Bibliography. ... The Norwegian Museum of Architecture . ... Art Museums . ... Henie-Onstad Art Center - Hovikodden: Norway's first Museum of Fine Arts on Internet. The Astrup Fearnley Museum of Modern Art . ... National Museum of American Art . Dallas Museum of Art . ... Electra '96 Henie Onstad Art Center's Project for Electronic Media. ... WWW-Library: History of Art . ... News: rec.fine.arts . ... News: k12.ed.art . ...
astro-ph/0702647 Открытие самой широкой очень маломассивной двойной (Discovery of the Widest Very Low Mass Binary) . ... Authors: John Stansberry, et al. astro-ph/0702347 Необычный двойной пульсар PSR J1744-3922: переменность радио потока, наблюдения в ближнем ИК и эволюция (The Unusual Binary Pulsar PSR J1744-3922: Radio Flux Variability, Near-infrared Observation and Evolution) . ... обзор astro-ph/0702068 Исторические наблюдения солнечных пятен: обзор (Historical Sunspot Observations: A Review) . ...
Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
The Day the World Changed Vocabulary Expressions I Task1. ... Nazi war criminals committed appalling atrocities during World War II. 2.debris a quality of being well known for evil, esp. morally wicked actions. After the bombing there was a lot of debris everywhere. 3.resolve an act of great evil, esp. cruelty, shocking, terrible. ... He didn't seem daunted by the difficulties facing him. 9.infamy smth that needs attention, consideration, service, being more important than anything else. ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf -- 1103.7 Кб -- 02.10.2011 Похожие документы
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... в рамках регулярного семинара по проекту Живой камень: от минералогии к мифопоэтике состоится доклад Олеси Темиршиной . ... Приглашаются участники проекта, сотрудники Института, а также все желающие. 2-3 сентября, 10.30-13.45: 4 лекции по курсу 'История науки' РАШ РГГУ (м. Новослободская, центральный вход РГГУ, далее 5 корп., 7 подъезд, комната 105) . ... 6 сентября, 10:00 Специальная сессия Института мировой культуры Живой и мертвый камень и вокруг . ... Институт мировой культуры МГУ 2003-2014 . ...
яЛП . id #428 . The Journal of Visualization and Computer Animation [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1099-1778 . In print: . since 1997-01-01 till 2003-12-31 . Language: . en . Price: . single article - $1 . Classifier: . [no at all] . Comment: . From 2004: Computer Animations and Virtual Worlds . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit
... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease , ). ...
[
Текст
]
Ссылки http://www.soc-phys.chem.msu.ru/rus/prev/zas-2015-12-01/presentation.pdf -- 1351.3 Кб -- 25.12.2015 Похожие документы
... Расписание заседаний Десятого международного форума "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности". ... Институт проблем информационной безопасности МГУ имени М.В.Ломоносова начал подготовку к Десятому международному форуму "Партнерство государства, бизнеса и гражданского общества при обеспечении международной информационной безопасности", который состоится 25-28 апреля 2016 года в г. Гармиш-Партенкирхен, Германия. ...
Исследование процессов сорбции пирена почвами. ... Выполнено теоретическое и экспериментальное исследование и рассмотрена методика математического моделирования процессов сорбции и десорбции пирена почвами различного состава. Образцы проб почв были получены из различных регионов (штатов США: Огайо, Нью-Мексико и федерального округа Колумбия). Представлена информация о составе и свойствах проб почв, использовавшихся при проведении исследований сорбции и десорбции пирена этими почвами. ...
... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... Seminar archive . ... Seminar archive 2011 3 June . ... Tristram K. D. A torus of molecular gas and dust is one of the key components of unified schemes of active galactic nuclei (AGN): it provides the material for accretion onto the supermassive black hole and is held responsible for the orientation-dependent obscuration of the central engine. I will present the results and current status of infrared interferometry of these dust distributions in AGN in the infrared. ... All seminars: . ...