... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>6) - io.cmc.msu.ru/ )

ISSN 1560-3547, Regular and Chaotic Dynamics, 2007, Vol. ... RESEARCH ARTICLES Interaction between Kirchhoff Vortices and Point Vortices in an Ideal Fluid A. V. Borisov* and I. S. Mamaev ** Institute of Computer Science, Udmurt State University, Universitetskaya ul. 1, 426034 Izhevsk, Russia Received March 1, 2005; accepted January 14, 2006 Abstract--We consider the interaction of two vortex patches (elliptic Kirchhoff vortices) which move in an unbounded volume of an ideal incompressible fluid. ...

Еще в разделе: (Показать все результаты (>50) - ics.org.ru/ )

... Cell Biol, 1997, Vol. 11 (2), pp. ... In the cells polarized at the edge of an experimental wound, cytoplasmic granules moved randomly (Brownian motions) and by separate jumps (saltatory movements). ... In such cells, we observed radial tracks (going from the nucleus to the edge of the lamella) and tangential tracks (when the movement of the granule was tangential to the nucleus). ... In the spread part of the leading edge of a cell, as a rale, not more than two granules (3-4%) proved out of focus. ...

Еще в разделе: (Показать все результаты (>29) - cellmotility.genebee.msu.ru/ )

• Alieva Irina
• publications2

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

205. http://www.elch.chem.msu.ru/mole/lecture/qavdeev.pdf

206. http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf

207. http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

208. Opening of the educational programme - School of CEOs, "Capsule of security"

209. http://www.antropos.msu.ru/vestnic/e2014_1.doc

210. http://physelec.phys.msu.ru/science/surface/publ.doc

211. Кафедра квантовой теории и физики высоких энергий

212. 5-th All-Russian Conference "Nitrides of gallium, indium and aluminum:

213. Professor Alexander P. Seyranian

214. About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

215. Магистратура ВМК МГУ - подготовка ERP-программистов, консультантов SAP