... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
. Yu.A.Shokin . Accurate positions of variable stars in the western part of the Large Magellanic Cloud bar . (published in IBVS and SAI Proceedings ) . B.S.Vozdvijenski, N.P.Gorbatko, V.A.Yeliseev, G.V.Romanova . The results of the observations of the selected minor planets in Sternberg State Astronomical institute . (published in SAI Proceedings ) .
Fluorescence , Diffuse Reflectance and NIR Imaging in Cardiovascular Research and Diagnostics Gussakovsky E., Kupriyanov V., Sowa M. Institute for Biodiagnostics, National Research Council Canada 435 Ellice Ave, Winnipeg, Manitoba R3B 1Y6 Canada Tel. 1-204-984-4501; email: Eugene.Gussakovsky@nrc-cnrc.gc.ca Three selected topics of VIS-NIR spectroscopy intrinsic fluorescence , diffuse ... An Alentsev-Fok approach-assisted decomposition revealed three major and a few minor components. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...
... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...
... Dear book contributors of the NATO ARW, . following the ARW workshop the organizing committee has agreed to the following procedure in order to expedite the process of preparation, distribution and review of the individual manuscripts: . ... The manuscripts received will be sent by Norbert Hertkorn (GSF-Germany) and Irina Perminova (MGU/Russia) for review, typically to two different other authors which also have been participants of the NATO ARW, or to the independent appropriate reviewers. ...
... Вычисление собственных вектоpов верхней комплексной матрицы Хессенберга, соответствующих указанным собственным значениям. Подпрограмма aet3c_c по заданным собственным значениям верхней комплексной матрицы Хессенберга A вычисляет соответствующие собственные векторы с помощью метода обратных итераций. ... где - задаваемое приближение к собственному значению матрицы A, решаются методом Гаусса с выбором ведущего элемента по столбцу. ... Линейная алгебра. ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
Dmitriy Mendeleev . ... Dmitry Ivanovich Mendeleev : A project of undergraduate students from School No.470 (St.Petersburg) . ... Brokhaus Online: Biography of Mendeleev in Russian . ... Original Periodic Table by Mendeleev . ... Mendeleev's "Principles of Chemistry" (4 Pts. in 2 Vols) . ... Mendeleev's house museum in the village Boblovo, Moscow region (in Russian) . Statue of Mendeleev in front of Chemistry Department at Moscow State University (from the article about Russian chemistry in Chem. ...
The Converter of Measurement Units is aimed to converting of measurement units between different systems of measurement, for example from British-American units of measurement to metric system and vice versa. To convert a value . ... On the left panel list select a measure you want to convert . ... Select the measurement unit you want to convert from . ... Select the measurement unit you want to convert to . ... Result is displayed in the "Conversion Result" area. ...
... 7.1] Lectures of prof. Scrucca in Advanced quantum field theory (e.g., for the first study of the worldline formalism): http://itp.epfl.ch/webdav/site/itp/users/181759/public/aqft.pdf . ... I. Topological quantum effects Lecture 1 (Spring 2015) , The Outline Before Casimir: the van der Waals forces (presentation, pdf) . ... Lecture 5 (Fall 2015) , Lattice field theory: 'free fields' (presentation, pdf) . Lectures 6-7 (Fall 2015) , Lattice field theory: 'interacting fields'. ...
... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...