... Доцент . ... Роль новых информационных технологий в обучении иностранным языкам . Кабардино-Балкарский государственный университет, кафедра английского языка. ... МГУ, Центр международного образования, кафедра русского языка для иностранцев. ... Global Understanding - проект по межкультурному общению на факультете иностранных языков и регионоведения МГУ . ФИЯР МГУ. ... Факультет иностранных языков и регионоведения МГУ, доцент . ... МГУ, факультет иностранных языков и регионоведения, доцент . ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
О кафедре . ... Главная -> Люди -> Сотрудники -> Мельников Николай Борисович . ... 2002 . ... МЕЛЬНИКОВ Николай Борисович родился 4 мая 1976 г. в . ... Окончил с отличием механико-математический факультет МГУ (1998) и его аспирантуру (2001). С 2002 г. - доцент кафедры оптимального управления. ... L02705 (co-auth.: ... P. 23-44. (co-auth.: ... Ведет занятия по оптимальному управлению и функциональному анализу. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...
... Process of Forming a Company . ... Инновационная . структура МГУ . ... деятельности . ... Finance for Start-Up . ... Spin-off Company Development at the University of Alberta . ... Spin-off Company Development - Program Guidelines . ... However, these questions may help you determine if the time is right or wrong to proceed with a start-up company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Звезды типа Миры Кита и полуправильные Среди пульсирующих переменных звезд поздних классов видное место занимают долгопериодические переменные звезды (ДПП). ... Изменения блеска мирид происходят более или менее регулярно, периоды большинства мирид находятся в интервале от 150 до 600 суток ( рис. ... В 4-м издании Общего каталога переменных звезд (ОКПЗ) ДПП (включая переменные типа Миры Кита, или мириды, и полуправильные переменные поздних классов) составляют самую многочисленную группу переменных. ...
... We will dwell on linguistic aspects and Lexical Resources of POLITEXT branch having in mind some intermediate semantic representation of a whole text as the basis for differentiated Information Extraction. It is personal data (in the social sphere) recognition in texts that we focus on, see (Leontyeva et al. ... As the main instrument of semantic analysis of coherent texts this dictionary bears the important information on how to build BTF-units starting from lexemes of SemDict entries. ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... info@ecfs.msu.ru . ... Eurasian Center . for Food Security . ... Topic 1: Building the Eurasian Food Security.. ... We are inviting you to participate in our consultation on Building the Eurasian Food Security Network. ... What kind of international experience we need to consider in order to a build the Eurasian Food Security Network? ... Приглашаем вас принять участие в нашей консультации на тему ?Создание Евразийской сети по продовольственной безопасности?. ... Food, hence, is expensive. ...
... Цикл статей «Регулирование активности ДНК-связывающих ферментов» Агапкина Юлия Юрьевна, старший научный сотрудник химического факультета Зацепин Тимофей Сергеевич, научный сотрудник химического факультета 2. статья «Find It If You Can: A Game for Modeling Different Types of Web Search Success Using Interaction Data (Моделирование различных определений ... Цикл статей «Самоаффинные многогранники и аффинные инварианты выпуклых тел. ...
[
Текст
]
Ссылки http://expertise.msu.ru/sites/default/files/2012_deripaska_results.doc -- 151.5 Кб -- 02.01.2013 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... 4 1.1 Основные одночастичной механики положения квантовой Главный постулат квантовой механики состоит в том, что вся динамика любой системы определяется ее волновой функцией, которая является комплексной функцией от координат все частиц, составляющих эту систему: (t, r1 , r2 , . ... Эта волновая функция должна рассматриваться как вектор в гильбертовом пространстве состояний функции n частичной системы. ... j =1 32 Запутанные состояния играют центральную роль в квантовой теории многих частиц. ...
[
Текст
]
Ссылки http://sqi.cs.msu.su/store/storage/th25kzj_quantum_computer.pdf -- 426.1 Кб -- 25.11.2014 Похожие документы
. Маргиналии 2008: периферия культуры и границы текста. Вступительное слово . Гуманитарное знание предлагает традиционное членение предметных сфер, которыми занимаются специалисты, работающие в конкретных областях знаний. При этом целые пласты явлений оказываются маргинальными, попадают на 'ничейную' территорию, находящуюся между - лингвистикой и психологией, философией и историей, искусствоведением и социологией и т. д. Между тем анализ подобных явлений, обращение к пластам еще не осмысленного материала
Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011
[
Текст
]
Ссылки http://botsad.msu.ru/docs/eng_iris2.doc -- 901.5 Кб -- 24.02.2011 Похожие документы
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...