... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures . Tatiana A. Dolenko . ... Modern methods and possibilities of laser Raman spectroscopy. ... Vibrational spectroscopy of water solutions of amphiphilic compounds. ... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. ... Comparison of Input Data Compression Methods in Neural Network Solution of Inverse Problem in Laser Raman Spectroscopy of Natural Waters. ...
J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. С 25 октября по 7 декабря 2012 года . Выход в город . Мемориальная квартира Андрея Белого участник просветительского проекта Департамента культурного наследия Москвы Выход в город . Информацию о проекте см. здесь: . http://vihod-v-gorod.ru/programm/index.php?filterDate=&filterProgramm=14154&filterFormat=&filterGuide = , . https://www.facebook.com/vihodvgorod , http://vihod-v-gorod.ru/gallery/30417/ . Запись на экскурсии в музей на сайте программы Выход в город : http://vihod-v-gorod.ru/about/kontakty/ .
... The method is based on the versal deformation theory for matrix pairs under feedback equivalence. ... Similarly, we can calculate a regular part of the uncontrollability set, corresponding to matrix pairs of J type, which is a smooth surface for a three-parameter oneinput dynamical system. Recall that, by Theorem 3.1, the surfaces corresponding to matrix pairs of J and J‘i types, together with their boundaries, form the whole uncontrollability set of a generic multi-input linear dynamical system. ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) . ... L.S.Pontryagin, P.S.Alexandrov and A.N.Kolmogorov . ... Photo by A.I.Pontryagina In the beginning of the 50s, L.S. went into (broadly understood) theory of ordinary differential equations, which had episodically drawn his interest earlier. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
ORM2010 Mechanisms for corruption suppression Alexander Vasin Pavel Nikolaev Anton Urazov Lomonosov Moscow State University The research was supp orted by Grant of the President of the Russian ... -00249 #693.2008.1 #08-01-00249 1 / 34 Introduction Government agencies and large corporations meet similar problems related to control of agents dealing with outsiders: citizens under audit of the agency or clients of the company ... 2005 . ... tl ) · fi + bil < fi , < X bil > pl+1 (t0 , . ... 2009. ...
[
Текст
]
Ссылки http://io.cs.msu.ru/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010
[
Текст
]
Ссылки http://io.cs.msu.su/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010
[
Текст
]
Ссылки http://io.cmc.msu.ru/ORM_present/Vasin_Nikolaev_Urazov.pdf -- 386.1 Кб -- 18.10.2010 Похожие документы
... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...
... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... XI--XVII . ... Ac A d e m I c r e A d I N g S Conference «Old Russian literature and television» M.V. Ivanova. old russian literature and contemporary russian television . ... e-mail: lanskoy@mail.ru. ... online. 28 2007, 13:00. http://www. expert.ru/interview/2007/03/28/pavlovsky/ 21 , , , . ... 2006, 39. http://www.expert. ru/printissues/expert/2006/39/prodazha_livejournal/print 22 , . ... 2007, 31. . ... 1917--1918 . ... Key words: Old Russian literature, plot, demonology, old printing Prologue. ...
[
Текст
]
Ссылки http://www.ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010
[
Текст
]
Ссылки http://ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
Ботанический сад Московского Государственного Университета им. М.В. Ломоносова Российское Общество Ириса Задачи Международного сотрудничества ирисоводов (Тезисы докладов) Москва 2005 Посвящается: 250-летию Московского Государственного Университета имени М. В. Ломоносова и 300-летию Ботанического сада Московского Государственного университета Тезисы докладов Международного Симпозиума «Задачи международного сотрудничества ... Ирисы, как объект исследования. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010
[
Текст
]
Ссылки http://botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010 Похожие документы
... Формулировка основных требований к спектральной аппаратуре, фотодетекторам и источников первичного излучения Курс посвящен физическим основам квантовой электроники, освоению основных понятий теории взаимодействия поля и вещества (вынужденное излучение и поглощение, инверсия населенностей и отрицательная температура, сечение взаимодействия, диэлектрическая восприимчивость, релаксация, спонтанные переходы, когерентное взаимодействие). ... Вид работы |Семестр |Всего | ... работы. ... условий работы ФЭУ...
[
Текст
]
Ссылки http://quantum.phys.msu.ru/sites/default/files/downloads/114/osnovy-korr.spektroskopii.doc -- 163.5 Кб Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...