. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>6) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

• RTM-CS

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>115) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | рассказ в тему

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright © 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>7) - wwwlib.phys.msu.ru/ )

... 000, 1ґ12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/arXiv1102.1159.pdf

Gamma-rays above 10 TeV Dieter Horns ґ University Hamburg RXJ1713-3946 [HESS Coll. ... The indirect path to the accelerator sky Dieter Horns ґ University Hamburg Is it a good deal? [astro-ph/0607109] Unveiling Cosmic Ray accelerators: Interstellar medium ( B-field + gas + photons) Accelerated Nuclei Meson production via inelastic scattering Gamma-rays , Neutrinos Cosmic rays Neutral particles (photons neutrinos) retain directional information: Accelerator sky Charged particles ( ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Khrenov.pdf

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>2) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...

Еще в разделе: (Показать все результаты (>2) - sphere.sinp.msu.ru/ )

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>40) - acoustics.phys.msu.ru/ )

• A.V.Shanin

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI ? ? - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/files/publications.pdf

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>5) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html

ARM . 12: Ї ARM 2 ARM Powered Products 3 ARM Ї 4 Ї ARM 32- . ARM : ґ Byte - 8 bits ґ Halfword - 16 bits ( ) ґ Word - 32 bits ( ) Ї ARM ґ 32-bit ARM Instruction Set ґ 16-bit Thumb Instruction Set 5 Ї ARM : ґ User : , ґ FIQ : , high priority (fast) ґ IRQ : , low priority (normal) ґ Supervisor : Software Interrupt instruction ґ Abort : ґ Undef : ґ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

FACULTAD DE CIENCIAS POLITICAS DE LA UNIVERSIDAD ESTATAL DE MOSCз M. V. LOMONсSOV Encargado del cargo de Decano - El doctor de ciencias historicas, Profesor (A. Yu. ... Al dia de hoy en la Facultad de Ciencias Politicas, funcionan cinco catedras: . ... La Facultad de Ciencias Politicas presta la posibilidad de realizar estudios especializados en los siguientes programas de estudio por contracto, los cuales han sido diseЯados con base a las necesidades del mercado laboral. ...

Еще в разделе: (Показать все результаты (>13) - polit.msu.ru/ )

• http://polit.msu.ru/pub/fl-doc/French.doc
• Профессор Елена Борисовна Шестопал приняла участие в конференции Кембриджского

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>2) - dionis.sai.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master program "Information Security and Cryptography" | Магистерское и

The monitoring of the optics quality of DIMM instrument V. Kornilov, B. Safonov May 24, 2010 1 Intro duction A quantitative theory of measurement of optical turbulence (OT) with Differential Image Motion Monitor (DIMM) is based on certain priori assumptions [1]. ... Bottom: behavior of the instrumental Strehl's number for the left (triangle to the left) and right (triangle to the right) DIMM images during the period of measurement the maintenance of an additional correction factor seems superfluous. ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_specs.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>7) - hsmi.msu.ru/ )

/pdb/pdb2xc7.pdb pdb2xc7.out 2 # duplex 1 # number of base-pairs 1 0 # explicit bp numbering/hetero atoms 107 108 1 # 1 + ...1>P:.602_:[..C]C-**+-G[..G]:.603_:P<...1 8.46 0.83 46.97 6.51 11.46 ##### Base-pair criteria used: 4.00 0.00 15.00 2.50 65.00 4.50 7.50 [ O N] ##### 1 non-Watson-Crick base-pair, and 1 helix (1 isolated bp) ##### Helix #1 (1): 1

Еще в разделе: (Показать все результаты (>4590) - mouse.belozersky.msu.ru/ )

• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/x3dna/1g2e.pdb1.pdb.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/x3dna/1nb7.pdb2.pdb.txt
• http://mouse.belozersky.msu.ru/npidb/data/pdb_new/x3dna/1eyg.pdb1.pdb.txt