... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>4) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>43) - cdfe.sinp.msu.ru/ )

• EXFOR Search Engine
• CDFE => Online Services => Relational ENSDF
• CDFE => Online Services => Nucleus Ground State Parameters

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... Russian: ps 2 pages . Published in: Russian Math. Surveys 57 (2002), no.3. ... English: ps (gzipped) 41 pages . ... Finitely presented groups and semigroups in knot theory. Russian: ps (gzipped) tex . English: ps (gzipped) tex . ... Russian: ps (gzipped) English: ps 20 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.RA/0205042 . ... Russian: ps English: ps 11 pages . ... In this paper we introduce and study gauge-equivariant $K$-theory groups $K_\GR^i(Y)$. ...

Еще в разделе: (Показать все результаты (>131) - higeom.math.msu.su/ )

• Alexey Garber
• Publications (Russian)
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/Trudy/Publications/1971

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>149) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>12) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics
• Publications

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>10) - hit-conf.imec.msu.ru/ )

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

220. Факультет иностранных языков МГУ им.М.В.Ломоносова