4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

Contemplating the evolution of Surface Nonlinear Optics seems to be highly instructive, able to stimulate one's own creativity and deeper understanding of current trends in this field. ... Hence, the Surface Nonlinear Optics Map, in its starting version, presents the names of researchers having made prominent scientific contributions to this branch of Optics. Related websites are accessible by clicking the corresponding names. ...

Еще в разделе: (Показать все результаты (>52) - shg.phys.msu.ru/ )

• List of selected publications

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>21) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

GCVS Research Group: . Recent publications . Kazarovets E.V., Samus N.N., Durlevich O.V., Kireeva N.N., Pastukhova E.N., The 81st Name-List of Variable Stars. ... Kazarovets E.V., Samus N.N., Durlevich O.V., Kireeva N.N., Pastukhova E.N., The 80th Name-List of Variable Stars. ... Samus N.N., Kazarovets E.V., Kireeva N.N., Pastukhova E.N., Durlevich O.V. General Catalogue of Variable Stars: Current status and new Name-lists Odessa Astronomical Publications, 2010, V. 23, p. 102-105. ...

Еще в разделе: (Показать все результаты (>126) - sai.msu.ru/ )

• International School "Frontiers in Numerical Gravitational Astrophysics"

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>13) - iisi.msu.ru/ )

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>18) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80522.pdf

Nuclear Instruments and Methods in Physics Research B 150 (1999) 622±627 Roman mosaic glass : a study of production processes, using PIXE spectrometry S.J . Fleming a, C.P . Swann a b b,* MASCA, University of Pennsylvania Museum, Philadelphia, PA 19104, USA Bartol Research Institute, University of Delaware, Newark, DE 19716, USA Abstract The most attractive Roman glass produced during the early part of the 1st century A.D.. was ... Roman mosaic glass During the reign of Augustus (27 B . ...

Еще в разделе: (Показать все результаты (>99) - hbar.phys.msu.ru/ )

• Appendix: Scaliger's List of Eras
• Historical Eclipses

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>139) - www.enzyme.chem.msu.ru/ )

• Murygina-E
• Sklyar-E

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>161) - higeom.math.msu.su/ )

• Alexey Garber
• INVITED ADDRESSES:
• S.P.Novikov Seminar

Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>12) - suny.msu.ru/ )

• Center on Russia and the United States :: Publications

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>3) - npidb.belozersky.msu.ru/ )

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>62) - brain.bio.msu.ru/ )

• S.Borisov

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>2) - swx.sinp.msu.ru/ )

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>19) - optics.sinp.msu.ru/ )

The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...

Еще в разделе: (Показать все результаты (>5) - mguteam.chat.ru/ )

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>28) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search